EMAIL THIS PAGE TO A FRIEND

MARCH9

membrane-associated ring finger (C3HC4) 9

140 Gene Product Result for
Synonyms: MARCH-IX RNF179
UniProtKB ID: Q86YJ5, B2R9U9, Q86VN5, Q96GG2
Gene ID:
Human(92979) Summary: MARCH9 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH enzymes add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH9 induces internalization of several membrane glycoproteins and directs them to the endosomal compartment (Bartee et al., 2004 [PubMed 14722266]
Mouse(216438) membrane-associated ring finger (C3HC4) 9
Rat(679272) membrane-associated ring finger (C3HC4) 9
sheep(101119129) membrane-associated ring finger (C3HC4) 9
naked mole-rat(101701204) membrane-associated ring finger (C3HC4) 9
domestic guinea pig(100714424) membrane-associated ring finger (C3HC4) 9
Zebrafish(100003493) membrane-associated ring finger (C3HC4) 9
domestic cat(101082835) membrane-associated ring finger (C3HC4) 9
dog(481132) membrane-associated ring finger (C3HC4) 9
cow(540871) membrane-associated ring finger (C3HC4) 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138396 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138396 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138396 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033262 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033262 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033262 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU154961 MISSION® esiRNA esiRNA human MARCH9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138396 Rosetta Predictions human pricing
NM_001100601 Rosetta Predictions rat pricing
NM_001033262 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138396 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208183 predicted 1187
2 SASI_Hs01_00208184 predicted 1855
3 SASI_Hs01_00208185 predicted 1014
4 SASI_Hs01_00208186 predicted 1846
5 SASI_Hs01_00208187 predicted 1561
6 SASI_Hs01_00208188 predicted 1468
7 SASI_Hs01_00208189 predicted 1401
8 SASI_Hs01_00208190 predicted 1848
9 SASI_Hs01_00208191 predicted 1461
10 SASI_Hs01_00208192 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100601 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210138 predicted 1296
2 SASI_Rn02_00210139 predicted 601
3 SASI_Rn02_00210140 predicted 1111
4 SASI_Rn02_00210141 predicted 1083
5 SASI_Rn02_00210142 predicted 723
6 SASI_Rn02_00210143 predicted 1068
7 SASI_Rn02_00210144 predicted 725
8 SASI_Rn02_00210145 predicted 1157
9 SASI_Rn02_00210146 predicted 808
10 SASI_Rn02_00210147 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033262 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131152 predicted 1752
2 SASI_Mm01_00131153 predicted 915
3 SASI_Mm01_00131154 predicted 1534
4 SASI_Mm01_00131155 predicted 1631
5 SASI_Mm01_00131156 predicted 958
6 SASI_Mm01_00131157 predicted 1024
7 SASI_Mm01_00131158 predicted 995
8 SASI_Mm01_00131159 predicted 1674
9 SASI_Mm01_00131160 predicted 969
10 SASI_Mm01_00131161 predicted 928
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138396
VALIDATED
MARCH9 MISSION shRNA Bacterial Glycerol Stock
membrane-associated ring finger (C3HC4) 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138396.4-1414s21c1
Sequence:CCGGTTCTGGCCGAGAGGTTGTCATCTCGAGATGACAACCTCTCGGCCAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138396.4-959s21c1
Sequence:CCGGGTCCAGATTGCTGCCATAGTTCTCGAGAACTATGGCAGCAATCTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138396.4-1183s21c1
Sequence:CCGGGCAGTGGAAGGTCCTAAATTACTCGAGTAATTTAGGACCTTCCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138396.4-1345s21c1
Sequence:CCGGGCGCTGCGGTTATACAATCTTCTCGAGAAGATTGTATAACCGCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138396.4-1720s21c1
Sequence:CCGGCCCTGGAGAGAACCGTCTTTACTCGAGTAAAGACGGTTCTCTCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_138396.3-959s1c1
Sequence:CCGGGTCCAGATTGCTGCCATAGTTCTCGAGAACTATGGCAGCAATCTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138396.3-1195s1c1
Sequence:CCGGCCTAAATTATGACAAGACCAACTCGAGTTGGTCTTGTCATAATTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_138396.3-1183s1c1
Sequence:CCGGGCAGTGGAAGGTCCTAAATTACTCGAGTAATTTAGGACCTTCCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_138396.3-1345s1c1
Sequence:CCGGGCGCTGCGGTTATACAATCTTCTCGAGAAGATTGTATAACCGCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_138396.3-823s1c1
Sequence:CCGGGCCCTGCCTCATCCGCTGGATCTCGAGATCCAGCGGATGAGGCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138396
VALIDATED
MARCH9 MISSION shRNA shRNA Plasmid DNA
membrane-associated ring finger (C3HC4) 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138396.4-1414s21c1
Sequence:CCGGTTCTGGCCGAGAGGTTGTCATCTCGAGATGACAACCTCTCGGCCAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138396.4-959s21c1
Sequence:CCGGGTCCAGATTGCTGCCATAGTTCTCGAGAACTATGGCAGCAATCTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138396.4-1183s21c1
Sequence:CCGGGCAGTGGAAGGTCCTAAATTACTCGAGTAATTTAGGACCTTCCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138396.4-1345s21c1
Sequence:CCGGGCGCTGCGGTTATACAATCTTCTCGAGAAGATTGTATAACCGCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138396.4-1720s21c1
Sequence:CCGGCCCTGGAGAGAACCGTCTTTACTCGAGTAAAGACGGTTCTCTCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_138396.3-959s1c1
Sequence:CCGGGTCCAGATTGCTGCCATAGTTCTCGAGAACTATGGCAGCAATCTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138396.3-1195s1c1
Sequence:CCGGCCTAAATTATGACAAGACCAACTCGAGTTGGTCTTGTCATAATTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_138396.3-1183s1c1
Sequence:CCGGGCAGTGGAAGGTCCTAAATTACTCGAGTAATTTAGGACCTTCCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_138396.3-1345s1c1
Sequence:CCGGGCGCTGCGGTTATACAATCTTCTCGAGAAGATTGTATAACCGCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_138396.3-823s1c1
Sequence:CCGGGCCCTGCCTCATCCGCTGGATCTCGAGATCCAGCGGATGAGGCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138396
VALIDATED
MARCH9 MISSION shRNA Lentiviral Transduction Particles
membrane-associated ring finger (C3HC4) 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138396.4-1414s21c1
Sequence:CCGGTTCTGGCCGAGAGGTTGTCATCTCGAGATGACAACCTCTCGGCCAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138396.4-959s21c1
Sequence:CCGGGTCCAGATTGCTGCCATAGTTCTCGAGAACTATGGCAGCAATCTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138396.4-1183s21c1
Sequence:CCGGGCAGTGGAAGGTCCTAAATTACTCGAGTAATTTAGGACCTTCCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138396.4-1345s21c1
Sequence:CCGGGCGCTGCGGTTATACAATCTTCTCGAGAAGATTGTATAACCGCAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138396.4-1720s21c1
Sequence:CCGGCCCTGGAGAGAACCGTCTTTACTCGAGTAAAGACGGTTCTCTCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_138396.3-959s1c1
Sequence:CCGGGTCCAGATTGCTGCCATAGTTCTCGAGAACTATGGCAGCAATCTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138396.3-1195s1c1
Sequence:CCGGCCTAAATTATGACAAGACCAACTCGAGTTGGTCTTGTCATAATTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_138396.3-1183s1c1
Sequence:CCGGGCAGTGGAAGGTCCTAAATTACTCGAGTAATTTAGGACCTTCCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_138396.3-1345s1c1
Sequence:CCGGGCGCTGCGGTTATACAATCTTCTCGAGAAGATTGTATAACCGCAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_138396.3-823s1c1
Sequence:CCGGGCCCTGCCTCATCCGCTGGATCTCGAGATCCAGCGGATGAGGCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033262
MARCH9 MISSION shRNA Bacterial Glycerol Stock
membrane-associated ring finger (C3HC4) 9
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000265217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033262.2-915s21c1
Sequence:CCGGTGGCGATCAGCACCAAGAATCCTCGAGGATTCTTGGTGCTGATCGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033262.2-1549s21c1
Sequence:CCGGACGACCTAGACAACGTGTTTGCTCGAGCAAACACGTTGTCTAGGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033262.2-1361s21c1
Sequence:CCGGTTGCCTCAGCGCTGTGGTTATCTCGAGATAACCACAGCGCTGAGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033262.2-1142s21c1
Sequence:CCGGATCGTCCACGAAGGGTCTTCTCTCGAGAGAAGACCCTTCGTGGACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033262
MARCH9 MISSION shRNA shRNA Plasmid DNA
membrane-associated ring finger (C3HC4) 9
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000265217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033262.2-915s21c1
Sequence:CCGGTGGCGATCAGCACCAAGAATCCTCGAGGATTCTTGGTGCTGATCGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033262.2-1549s21c1
Sequence:CCGGACGACCTAGACAACGTGTTTGCTCGAGCAAACACGTTGTCTAGGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033262.2-1361s21c1
Sequence:CCGGTTGCCTCAGCGCTGTGGTTATCTCGAGATAACCACAGCGCTGAGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033262.2-1142s21c1
Sequence:CCGGATCGTCCACGAAGGGTCTTCTCTCGAGAGAAGACCCTTCGTGGACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033262
MARCH9 MISSION shRNA Lentiviral Transduction Particles
membrane-associated ring finger (C3HC4) 9
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000265217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033262.2-915s21c1
Sequence:CCGGTGGCGATCAGCACCAAGAATCCTCGAGGATTCTTGGTGCTGATCGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251704    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033262.2-1549s21c1
Sequence:CCGGACGACCTAGACAACGTGTTTGCTCGAGCAAACACGTTGTCTAGGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033262.2-1361s21c1
Sequence:CCGGTTGCCTCAGCGCTGTGGTTATCTCGAGATAACCACAGCGCTGAGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033262.2-1142s21c1
Sequence:CCGGATCGTCCACGAAGGGTCTTCTCTCGAGAGAAGACCCTTCGTGGACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)