EMAIL THIS PAGE TO A FRIEND

MARCKS

myristoylated alanine-rich protein kinase C substrate

131 Gene Product Result for
Synonyms: 80K-L MACS PKCSL PRKCSL
UniProtKB ID: P29966, E1P560, Q2LA83, Q5TDB7
Gene ID:
Human(4082) Summary: The protein encoded by this gene is a substrate for protein kinase C. It is localized to the plasma membrane and is an actin filament crosslinking protein. Phosphorylation by protein kinase C or binding to calcium-calmodulin inhibits its association with actin and with the plasma membrane, leading to its presence in the cytoplasm. The protein is thought to be involved in cell motility, phagocytosis, membrane trafficking and mitogenesis. [provided by RefSeq, Jul 2008]
Mouse(17118) myristoylated alanine rich protein kinase C substrate
Rat(25603) myristoylated alanine rich protein kinase C substrate
chicken(396473) myristoylated alanine-rich protein kinase C substrate
dog(612436) myristoylated alanine-rich protein kinase C substrate
cow(613548) myristoylated alanine-rich protein kinase C substrate
domestic cat(101094421) myristoylated alanine-rich protein kinase C substrate
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA069443 Anti-MARCKS Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunohistochemistry, western blot pricing
SAB4300536 Anti-MARCKS (Ab-158) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunofluorescence, western blot pricing
SAB4300511 Anti-MARCKS (Ab-162) antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
SAB4501799 Anti-MARCKS antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, western blot pricing
SAB4501800 Anti-MARCKS antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
HPA051913 Anti-MARCKS antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
HPA054820 Anti-MARCKS antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB4300233 Anti-phospho-MARCKS (pSer158) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunofluorescence, western blot pricing
SAB4504462 Anti-phospho-MARCKS (pSer158) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4300210 Anti-phospho-MARCKS (pSer162) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence pricing
SAB4504463 Anti-phospho-MARCKS (pSer163) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry pricing
SAB4300274 Anti-phospho-MARCKS (pSer170) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
P0370 Anti-phospho-Myristoylated Alanine-Rich Protein Kinase C Substrate (pSer152/156) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
western blot pricing
WH0004082M6 Monoclonal Anti-MARCKS antibody produced in mouse clone 2C2, purified immunoglobulin, buffered aqueous solution mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404034 Monoclonal Anti-MARCKS antibody produced in mouse clone 2H4, purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0273 AQUA Peptide GEAAAERPGEAAVASSPS[K] human, rat pricing
AQ0272 AQUA Peptide AEDGAAPSPSSETP[K] mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002356 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002356 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002356 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008538 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008538 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008538 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002356 Rosetta Predictions human pricing
NM_008538 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164604 predicted 1828
2 SASI_Hs01_00164607 predicted 1744
3 SASI_Hs01_00164608 predicted 880
4 SASI_Hs01_00164609 predicted 1719
5 SASI_Hs01_00164610 predicted 495
6 SASI_Hs01_00164611 predicted 1478
7 SASI_Hs02_00333692 predicted 1725
8 SASI_Hs01_00164612 predicted 1700
9 SASI_Hs01_00164613 predicted 1630
10 SASI_Hs02_00333693 predicted 1739
11 SASI_Hs01_00164605 predicted 1764
12 SASI_Hs01_00164606 predicted 1797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008538 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140607 predicted 1749
2 SASI_Mm01_00140608 predicted 1678
3 SASI_Mm01_00140609 predicted 1317
4 SASI_Mm01_00140610 predicted 848
5 SASI_Mm01_00140612 predicted 1327
6 SASI_Mm01_00140615 predicted 1782
7 SASI_Mm02_00314133 predicted 1779
8 SASI_Mm01_00140616 predicted 1631
9 SASI_Mm02_00314134 predicted 1776
10 SASI_Mm02_00314135 predicted 1517
11 SASI_Mm01_00140611 predicted 1497
12 SASI_Mm01_00140613 predicted 1649
13 SASI_Mm01_00140614 predicted 1768
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002356
MARCKS MISSION shRNA Bacterial Glycerol Stock
myristoylated alanine-rich protein kinase C substrate
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002356.4-761s1c1
Sequence:CCGGCCTCGACTTCTTCGCCCAAGGCTCGAGCCTTGGGCGAAGAAGTCGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194936    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002356.4-2207s1c1
Sequence:CCGGCACATGAAGTTTGCAACTTTCCTCGAGGAAAGTTGCAAACTTCATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002356.4-846s1c1
Sequence:CCGGCTTCAAGAAGTCTTTCAAGCTCTCGAGAGCTTGAAAGACTTCTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002356.4-1546s1c1
Sequence:CCGGCCCACAGATCCCATCTCAAATCTCGAGATTTGAGATGGGATCTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002356.4-474s1c1
Sequence:CCGGGAATGGCCACGTGAAGGTAAACTCGAGTTTACCTTCACGTGGCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002356.4-876s1c1
Sequence:CCGGCTCCTTCAAGAAGAACAAGAACTCGAGTTCTTGTTCTTCTTGAAGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002356.4-1321s1c1
Sequence:CCGGCAGCCCGAGTGCAGTCCAGAACTCGAGTTCTGGACTGCACTCGGGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002356.4-485s1c1
Sequence:CCGGTGAAGGTAAACGGCGACGCTTCTCGAGAAGCGTCGCCGTTTACCTTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002356.4-867s1c1
Sequence:CCGGGAGCGGCTTCTCCTTCAAGAACTCGAGTTCTTGAAGGAGAAGCCGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002356.4-450s1c1
Sequence:CCGGGCCTTCCAAAGCGAACGGACACTCGAGTGTCCGTTCGCTTTGGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002356
MARCKS MISSION shRNA shRNA Plasmid DNA
myristoylated alanine-rich protein kinase C substrate
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002356.4-761s1c1
Sequence:CCGGCCTCGACTTCTTCGCCCAAGGCTCGAGCCTTGGGCGAAGAAGTCGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194936    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002356.4-2207s1c1
Sequence:CCGGCACATGAAGTTTGCAACTTTCCTCGAGGAAAGTTGCAAACTTCATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002356.4-846s1c1
Sequence:CCGGCTTCAAGAAGTCTTTCAAGCTCTCGAGAGCTTGAAAGACTTCTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002356.4-1546s1c1
Sequence:CCGGCCCACAGATCCCATCTCAAATCTCGAGATTTGAGATGGGATCTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002356.4-474s1c1
Sequence:CCGGGAATGGCCACGTGAAGGTAAACTCGAGTTTACCTTCACGTGGCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002356.4-876s1c1
Sequence:CCGGCTCCTTCAAGAAGAACAAGAACTCGAGTTCTTGTTCTTCTTGAAGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002356.4-1321s1c1
Sequence:CCGGCAGCCCGAGTGCAGTCCAGAACTCGAGTTCTGGACTGCACTCGGGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002356.4-485s1c1
Sequence:CCGGTGAAGGTAAACGGCGACGCTTCTCGAGAAGCGTCGCCGTTTACCTTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002356.4-867s1c1
Sequence:CCGGGAGCGGCTTCTCCTTCAAGAACTCGAGTTCTTGAAGGAGAAGCCGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002356.4-450s1c1
Sequence:CCGGGCCTTCCAAAGCGAACGGACACTCGAGTGTCCGTTCGCTTTGGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002356
MARCKS MISSION shRNA Lentiviral Transduction Particles
myristoylated alanine-rich protein kinase C substrate
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002356.4-761s1c1
Sequence:CCGGCCTCGACTTCTTCGCCCAAGGCTCGAGCCTTGGGCGAAGAAGTCGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194936    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002356.4-2207s1c1
Sequence:CCGGCACATGAAGTTTGCAACTTTCCTCGAGGAAAGTTGCAAACTTCATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002356.4-846s1c1
Sequence:CCGGCTTCAAGAAGTCTTTCAAGCTCTCGAGAGCTTGAAAGACTTCTTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002356.4-1546s1c1
Sequence:CCGGCCCACAGATCCCATCTCAAATCTCGAGATTTGAGATGGGATCTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002356.4-474s1c1
Sequence:CCGGGAATGGCCACGTGAAGGTAAACTCGAGTTTACCTTCACGTGGCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002356.4-876s1c1
Sequence:CCGGCTCCTTCAAGAAGAACAAGAACTCGAGTTCTTGTTCTTCTTGAAGGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002356.4-1321s1c1
Sequence:CCGGCAGCCCGAGTGCAGTCCAGAACTCGAGTTCTGGACTGCACTCGGGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002356.4-485s1c1
Sequence:CCGGTGAAGGTAAACGGCGACGCTTCTCGAGAAGCGTCGCCGTTTACCTTCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002356.4-867s1c1
Sequence:CCGGGAGCGGCTTCTCCTTCAAGAACTCGAGTTCTTGAAGGAGAAGCCGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002356.4-450s1c1
Sequence:CCGGGCCTTCCAAAGCGAACGGACACTCGAGTGTCCGTTCGCTTTGGAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008538
VALIDATED
MARCKS MISSION shRNA Bacterial Glycerol Stock
myristoylated alanine-rich protein kinase C substrate
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008538.1-1774s1c1
Sequence:CCGGGCCAAGATAATATGCCACTAACTCGAGTTAGTGGCATATTATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008538.1-863s1c1
Sequence:CCGGCTTCTCCTTCAAGAAGAGCAACTCGAGTTGCTCTTCTTGAAGGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008538.1-749s1c1
Sequence:CCGGCTCCTCCACGTCGTCGCCCAACTCGAGTTGGGCGACGACGTGGAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008538.1-456s1c1
Sequence:CCGGTCGTCGCCTTCCAAAGCAAATCTCGAGATTTGCTTTGGAAGGCGACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008538.2-866s21c1
Sequence:CCGGCTGAGCGGCTTCTCCTTCAAGCTCGAGCTTGAAGGAGAAGCCGCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008538.2-478s21c1
Sequence:CCGGCAAAGCAAATGGGCAGGAGAACTCGAGTTCTCCTGCCCATTTGCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008538.2-877s21c1
Sequence:CCGGCTCCTTCAAGAAGAGCAAGAACTCGAGTTCTTGCTCTTCTTGAAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008538.2-858s21c1
Sequence:CCGGCCTTCAAGCTGAGCGGCTTCTCTCGAGAGAAGCCGCTCAGCTTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008538.2-1407s21c1
Sequence:CCGGTCTACAACCAGGGATTGATTTCTCGAGAAATCAATCCCTGGTTGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008538.2-1683s21c1
Sequence:CCGGTCTATAGACATACCCATATATCTCGAGATATATGGGTATGTCTATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008538.2-466s21c1
Sequence:CCGGCTCGTCGCCTTCCAAAGCAAACTCGAGTTTGCTTTGGAAGGCGACGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008538.2-490s21c1
Sequence:CCGGGCAGGAGAATGGCCACGTAAACTCGAGTTTACGTGGCCATTCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008538.2-846s21c1
Sequence:CCGGCCTTCAAGAAGTCCTTCAAGCCTCGAGGCTTGAAGGACTTCTTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008538
VALIDATED
MARCKS MISSION shRNA shRNA Plasmid DNA
myristoylated alanine-rich protein kinase C substrate
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008538.1-1774s1c1
Sequence:CCGGGCCAAGATAATATGCCACTAACTCGAGTTAGTGGCATATTATCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008538.1-863s1c1
Sequence:CCGGCTTCTCCTTCAAGAAGAGCAACTCGAGTTGCTCTTCTTGAAGGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008538.1-749s1c1
Sequence:CCGGCTCCTCCACGTCGTCGCCCAACTCGAGTTGGGCGACGACGTGGAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008538.1-456s1c1
Sequence:CCGGTCGTCGCCTTCCAAAGCAAATCTCGAGATTTGCTTTGGAAGGCGACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008538.2-866s21c1
Sequence:CCGGCTGAGCGGCTTCTCCTTCAAGCTCGAGCTTGAAGGAGAAGCCGCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008538.2-478s21c1
Sequence:CCGGCAAAGCAAATGGGCAGGAGAACTCGAGTTCTCCTGCCCATTTGCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008538.2-877s21c1
Sequence:CCGGCTCCTTCAAGAAGAGCAAGAACTCGAGTTCTTGCTCTTCTTGAAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008538.2-858s21c1
Sequence:CCGGCCTTCAAGCTGAGCGGCTTCTCTCGAGAGAAGCCGCTCAGCTTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008538.2-1407s21c1
Sequence:CCGGTCTACAACCAGGGATTGATTTCTCGAGAAATCAATCCCTGGTTGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008538.2-1683s21c1
Sequence:CCGGTCTATAGACATACCCATATATCTCGAGATATATGGGTATGTCTATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008538.2-466s21c1
Sequence:CCGGCTCGTCGCCTTCCAAAGCAAACTCGAGTTTGCTTTGGAAGGCGACGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008538.2-490s21c1
Sequence:CCGGGCAGGAGAATGGCCACGTAAACTCGAGTTTACGTGGCCATTCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008538.2-846s21c1
Sequence:CCGGCCTTCAAGAAGTCCTTCAAGCCTCGAGGCTTGAAGGACTTCTTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008538
VALIDATED
MARCKS MISSION shRNA Lentiviral Transduction Particles
myristoylated alanine-rich protein kinase C substrate
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008538.1-1774s1c1
Sequence:CCGGGCCAAGATAATATGCCACTAACTCGAGTTAGTGGCATATTATCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008538.1-863s1c1
Sequence:CCGGCTTCTCCTTCAAGAAGAGCAACTCGAGTTGCTCTTCTTGAAGGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008538.1-749s1c1
Sequence:CCGGCTCCTCCACGTCGTCGCCCAACTCGAGTTGGGCGACGACGTGGAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008538.1-456s1c1
Sequence:CCGGTCGTCGCCTTCCAAAGCAAATCTCGAGATTTGCTTTGGAAGGCGACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008538.2-866s21c1
Sequence:CCGGCTGAGCGGCTTCTCCTTCAAGCTCGAGCTTGAAGGAGAAGCCGCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008538.2-478s21c1
Sequence:CCGGCAAAGCAAATGGGCAGGAGAACTCGAGTTCTCCTGCCCATTTGCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008538.2-877s21c1
Sequence:CCGGCTCCTTCAAGAAGAGCAAGAACTCGAGTTCTTGCTCTTCTTGAAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008538.2-858s21c1
Sequence:CCGGCCTTCAAGCTGAGCGGCTTCTCTCGAGAGAAGCCGCTCAGCTTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008538.2-1407s21c1
Sequence:CCGGTCTACAACCAGGGATTGATTTCTCGAGAAATCAATCCCTGGTTGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008538.2-1683s21c1
Sequence:CCGGTCTATAGACATACCCATATATCTCGAGATATATGGGTATGTCTATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008538.2-466s21c1
Sequence:CCGGCTCGTCGCCTTCCAAAGCAAACTCGAGTTTGCTTTGGAAGGCGACGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008538.2-490s21c1
Sequence:CCGGGCAGGAGAATGGCCACGTAAACTCGAGTTTACGTGGCCATTCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008538.2-846s21c1
Sequence:CCGGCCTTCAAGAAGTCCTTCAAGCCTCGAGGCTTGAAGGACTTCTTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)