EMAIL THIS PAGE TO A FRIEND

MARCKSL1

MARCKS-like 1

125 Gene Product Result for
Synonyms: F52 MACMARCKS MLP MLP1 MRP
UniProtKB ID: P49006, D3DPQ0, Q5TEE6, Q6NXS5
Gene ID:
Human(65108) Summary: This gene encodes a member of the myristoylated alanine-rich C-kinase substrate (MARCKS) family. Members of this family play a role in cytoskeletal regulation, protein kinase C signaling and calmodulin signaling. The encoded protein affects the formation of adherens junction. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene are located on the long arm of chromosomes 6 and 10. [provided by RefSeq, Jun 2012]
Mouse(17357) MARCKS-like 1
Rat(81520) MARCKS-like 1
chicken(770764) MARCKS-like 1
dog(612998) MARCKS-like 1
cow(539555) MARCKS-like 1
domestic cat(101081995) MARCKS-like 1
sheep(101105729) MARCKS-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023009 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023009 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023009 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010807 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010807 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010807 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU031701 MISSION® esiRNA esiRNA human MARCKSL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023009 Rosetta Predictions human pricing
NM_030862 Rosetta Predictions rat pricing
NM_010807 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023009 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143120 predicted 960
2 SASI_Hs02_00356272 predicted 988
3 SASI_Hs01_00143122 predicted 463
4 SASI_Hs01_00143124 predicted 662
5 SASI_Hs01_00143125 predicted 1000
6 SASI_Hs01_00143126 predicted 1155
7 SASI_Hs01_00143127 predicted 998
8 SASI_Hs01_00143128 predicted 996
9 SASI_Hs01_00143129 predicted 970
10 SASI_Hs02_00356273 predicted 1168
11 SASI_Hs01_00143121 predicted 994
12 SASI_Hs01_00143123 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030862 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069963 predicted 1174
2 SASI_Rn01_00069964 predicted 979
3 SASI_Rn01_00069965 predicted 455
4 SASI_Rn02_00264112 predicted 752
5 SASI_Rn01_00069966 predicted 984
6 SASI_Rn01_00069967 predicted 990
7 SASI_Rn01_00069968 predicted 827
8 SASI_Rn01_00069969 predicted 950
9 SASI_Rn01_00069971 predicted 940
10 SASI_Rn01_00069972 predicted 995
11 SASI_Rn01_00069970 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010807 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027824 predicted 996
2 SASI_Mm01_00027830 predicted 943
3 SASI_Mm02_00319392 predicted 1145
4 SASI_Mm02_00319393 predicted 825
5 SASI_Mm02_00319394 predicted 1068
6 SASI_Mm02_00319395 predicted 1003
7 SASI_Mm02_00319396 predicted 984
8 SASI_Mm02_00319397 predicted 956
9 SASI_Mm01_00027826 predicted 318
10 SASI_Mm02_00319398 predicted 1070
11 SASI_Mm01_00027823 predicted 808
12 SASI_Mm01_00027825 predicted 872
13 SASI_Mm01_00027827 predicted 771
14 SASI_Mm01_00027828 predicted 803
15 SASI_Mm01_00027829 predicted 475
16 SASI_Mm01_00027831 predicted 800
17 SASI_Mm01_00027832 predicted 806
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023009
VALIDATED
MARCKSL1 MISSION shRNA Bacterial Glycerol Stock
MARCKS-like 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023009.5-769s21c1
Sequence:CCGGGCGCTGAGCAGAATGAGTAGCCTCGAGGCTACTCATTCTGCTCAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156319    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023009.4-974s1c1
Sequence:CCGGCCAGTTGAAGATGGTCCCTTACTCGAGTAAGGGACCATCTTCAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023009.4-959s1c1
Sequence:CCGGGTTCTCCTCTTAAGGCCAGTTCTCGAGAACTGGCCTTAAGAGGAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023009.5-805s21c1
Sequence:CCGGGGGTGATCTCTAAGCTGCAAACTCGAGTTTGCAGCTTAGAGATCACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023009.4-501s1c1
Sequence:CCGGCTTCAAGAGAAATCGGAAGGACTCGAGTCCTTCCGATTTCTCTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023009.4-479s1c1
Sequence:CCGGCTTTCAAATTGAGCGGCCTGTCTCGAGACAGGCCGCTCAATTTGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023009.4-989s1c1
Sequence:CCGGCCCTTACAGCTTCCCAAGTTACTCGAGTAACTTGGGAAGCTGTAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023009.4-494s1c1
Sequence:CCGGGCCTGTCCTTCAAGAGAAATCCTCGAGGATTTCTCTTGAAGGACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023009.4-1300s1c1
Sequence:CCGGGCCTGTGAATCAACTGTGTCTCTCGAGAGACACAGTTGATTCACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023009.5-1080s21c1
Sequence:CCGGGCATAAGGCAGTTGTTGGTTTCTCGAGAAACCAACAACTGCCTTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023009.5-1171s21c1
Sequence:CCGGGCTTATACTCCCAAACCTTGACTCGAGTCAAGGTTTGGGAGTATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023009
VALIDATED
MARCKSL1 MISSION shRNA shRNA Plasmid DNA
MARCKS-like 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023009.5-769s21c1
Sequence:CCGGGCGCTGAGCAGAATGAGTAGCCTCGAGGCTACTCATTCTGCTCAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156319    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023009.4-974s1c1
Sequence:CCGGCCAGTTGAAGATGGTCCCTTACTCGAGTAAGGGACCATCTTCAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023009.4-959s1c1
Sequence:CCGGGTTCTCCTCTTAAGGCCAGTTCTCGAGAACTGGCCTTAAGAGGAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023009.5-805s21c1
Sequence:CCGGGGGTGATCTCTAAGCTGCAAACTCGAGTTTGCAGCTTAGAGATCACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023009.4-501s1c1
Sequence:CCGGCTTCAAGAGAAATCGGAAGGACTCGAGTCCTTCCGATTTCTCTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023009.4-479s1c1
Sequence:CCGGCTTTCAAATTGAGCGGCCTGTCTCGAGACAGGCCGCTCAATTTGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023009.4-989s1c1
Sequence:CCGGCCCTTACAGCTTCCCAAGTTACTCGAGTAACTTGGGAAGCTGTAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023009.4-494s1c1
Sequence:CCGGGCCTGTCCTTCAAGAGAAATCCTCGAGGATTTCTCTTGAAGGACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023009.4-1300s1c1
Sequence:CCGGGCCTGTGAATCAACTGTGTCTCTCGAGAGACACAGTTGATTCACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023009.5-1080s21c1
Sequence:CCGGGCATAAGGCAGTTGTTGGTTTCTCGAGAAACCAACAACTGCCTTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023009.5-1171s21c1
Sequence:CCGGGCTTATACTCCCAAACCTTGACTCGAGTCAAGGTTTGGGAGTATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023009
VALIDATED
MARCKSL1 MISSION shRNA Lentiviral Transduction Particles
MARCKS-like 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023009.5-769s21c1
Sequence:CCGGGCGCTGAGCAGAATGAGTAGCCTCGAGGCTACTCATTCTGCTCAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156319    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023009.4-974s1c1
Sequence:CCGGCCAGTTGAAGATGGTCCCTTACTCGAGTAAGGGACCATCTTCAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023009.4-959s1c1
Sequence:CCGGGTTCTCCTCTTAAGGCCAGTTCTCGAGAACTGGCCTTAAGAGGAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023009.5-805s21c1
Sequence:CCGGGGGTGATCTCTAAGCTGCAAACTCGAGTTTGCAGCTTAGAGATCACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023009.4-501s1c1
Sequence:CCGGCTTCAAGAGAAATCGGAAGGACTCGAGTCCTTCCGATTTCTCTTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023009.4-479s1c1
Sequence:CCGGCTTTCAAATTGAGCGGCCTGTCTCGAGACAGGCCGCTCAATTTGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156469    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023009.4-989s1c1
Sequence:CCGGCCCTTACAGCTTCCCAAGTTACTCGAGTAACTTGGGAAGCTGTAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023009.4-494s1c1
Sequence:CCGGGCCTGTCCTTCAAGAGAAATCCTCGAGGATTTCTCTTGAAGGACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157260    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023009.4-1300s1c1
Sequence:CCGGGCCTGTGAATCAACTGTGTCTCTCGAGAGACACAGTTGATTCACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023009.5-1080s21c1
Sequence:CCGGGCATAAGGCAGTTGTTGGTTTCTCGAGAAACCAACAACTGCCTTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023009.5-1171s21c1
Sequence:CCGGGCTTATACTCCCAAACCTTGACTCGAGTCAAGGTTTGGGAGTATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010807
VALIDATED
MARCKSL1 MISSION shRNA Bacterial Glycerol Stock
MARCKS-like 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010807.2-1293s1c1
Sequence:CCGGCCAGCTTGTGAAATCAACCATCTCGAGATGGTTGATTTCACAAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010807.2-443s1c1
Sequence:CCGGCCAAGAAGAAGAAGAAATTCTCTCGAGAGAATTTCTTCTTCTTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010807.3-1293s21c1
Sequence:CCGGCCAGCTTGTGAAATCAACCATCTCGAGATGGTTGATTTCACAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177817    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010807.2-1399s1c1
Sequence:CCGGCCCTCCCATTGTTGTAAATAACTCGAGTTATTTACAACAATGGGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010807.2-285s1c1
Sequence:CCGGCGTGAGAAGCAATGGAGACTTCTCGAGAAGTCTCCATTGCTTCTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010807.3-1400s21c1
Sequence:CCGGCCCTCCCATTGTTGTAAATAACTCGAGTTATTTACAACAATGGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010807.3-285s21c1
Sequence:CCGGCGTGAGAAGCAATGGAGACTTCTCGAGAAGTCTCCATTGCTTCTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010807.3-996s21c1
Sequence:CCGGCCTTACGGTTTCCCAAGTTAGCTCGAGCTAACTTGGGAAACCGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010807
VALIDATED
MARCKSL1 MISSION shRNA shRNA Plasmid DNA
MARCKS-like 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010807.2-1293s1c1
Sequence:CCGGCCAGCTTGTGAAATCAACCATCTCGAGATGGTTGATTTCACAAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010807.2-443s1c1
Sequence:CCGGCCAAGAAGAAGAAGAAATTCTCTCGAGAGAATTTCTTCTTCTTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010807.3-1293s21c1
Sequence:CCGGCCAGCTTGTGAAATCAACCATCTCGAGATGGTTGATTTCACAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177817    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010807.2-1399s1c1
Sequence:CCGGCCCTCCCATTGTTGTAAATAACTCGAGTTATTTACAACAATGGGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010807.2-285s1c1
Sequence:CCGGCGTGAGAAGCAATGGAGACTTCTCGAGAAGTCTCCATTGCTTCTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010807.3-1400s21c1
Sequence:CCGGCCCTCCCATTGTTGTAAATAACTCGAGTTATTTACAACAATGGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010807.3-285s21c1
Sequence:CCGGCGTGAGAAGCAATGGAGACTTCTCGAGAAGTCTCCATTGCTTCTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010807.3-996s21c1
Sequence:CCGGCCTTACGGTTTCCCAAGTTAGCTCGAGCTAACTTGGGAAACCGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010807
VALIDATED
MARCKSL1 MISSION shRNA Lentiviral Transduction Particles
MARCKS-like 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010807.2-1293s1c1
Sequence:CCGGCCAGCTTGTGAAATCAACCATCTCGAGATGGTTGATTTCACAAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010807.2-443s1c1
Sequence:CCGGCCAAGAAGAAGAAGAAATTCTCTCGAGAGAATTTCTTCTTCTTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010807.3-1293s21c1
Sequence:CCGGCCAGCTTGTGAAATCAACCATCTCGAGATGGTTGATTTCACAAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177817    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010807.2-1399s1c1
Sequence:CCGGCCCTCCCATTGTTGTAAATAACTCGAGTTATTTACAACAATGGGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010807.2-285s1c1
Sequence:CCGGCGTGAGAAGCAATGGAGACTTCTCGAGAAGTCTCCATTGCTTCTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010807.3-1400s21c1
Sequence:CCGGCCCTCCCATTGTTGTAAATAACTCGAGTTATTTACAACAATGGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010807.3-285s21c1
Sequence:CCGGCGTGAGAAGCAATGGAGACTTCTCGAGAAGTCTCCATTGCTTCTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010807.3-996s21c1
Sequence:CCGGCCTTACGGTTTCCCAAGTTAGCTCGAGCTAACTTGGGAAACCGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)