EMAIL THIS PAGE TO A FRIEND

MARCO

macrophage receptor with collagenous structure

54 Gene Product Result for
Synonyms: SCARA2
UniProtKB ID: Q9UEW3, Q9Y5S3
Gene ID:
Human(8685) Summary: The protein encoded by this gene is a member of the class A scavenger receptor family and is part of the innate antimicrobial immune system. The protein may bind both Gram-negative and Gram-positive bacteria via an extracellular, C-terminal, scavenger receptor cysteine-rich (SRCR) domain. In addition to short cytoplasmic and transmembrane domains, there is an extracellular spacer domain and a long, extracellular collagenous domain. The protein may form a trimeric molecule by the association of the collagenous domains of three identical polypeptide chains. [provided by RefSeq, Jul 2008]
Mouse(17167) macrophage receptor with collagenous structure
Rat(367391) macrophage receptor with collagenous structure
chicken(395488) macrophage receptor with collagenous structure
domestic cat(101083611) macrophage receptor with collagenous structure
cow(505632) macrophage receptor with collagenous structure
dog(476117) macrophage receptor with collagenous structure
sheep(101111074) macrophage receptor with collagenous structure
naked mole-rat(101708814) macrophage receptor with collagenous structure
domestic guinea pig(100716503) macrophage receptor with collagenous structure
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006770 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006770 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006770 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010766 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010766 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010766 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042961 MISSION® esiRNA esiRNA human MARCO (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006770 Rosetta Predictions human pricing
NM_001109011 Rosetta Predictions rat pricing
NM_010766 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006770 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198976 predicted 525
2 SASI_Hs01_00198977 predicted 1394
3 SASI_Hs01_00198978 predicted 1383
4 SASI_Hs01_00198979 predicted 1561
5 SASI_Hs01_00198980 predicted 538
6 SASI_Hs01_00198981 predicted 1562
7 SASI_Hs01_00198982 predicted 1429
8 SASI_Hs01_00198983 predicted 549
9 SASI_Hs02_00342278 predicted 264
10 SASI_Hs01_00198985 predicted 1569
11 SASI_Hs01_00198984 predicted 360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109011 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244294 predicted 808
2 SASI_Rn02_00244295 predicted 349
3 SASI_Rn02_00244296 predicted 721
4 SASI_Rn02_00244297 predicted 1734
5 SASI_Rn02_00244298 predicted 658
6 SASI_Rn02_00244299 predicted 377
7 SASI_Rn02_00244300 predicted 693
8 SASI_Rn02_00244301 predicted 532
9 SASI_Rn02_00244302 predicted 683
10 SASI_Rn02_00244303 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010766 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319301 predicted 1599
2 SASI_Mm01_00200135 predicted 732
3 SASI_Mm01_00200139 predicted 305
4 SASI_Mm01_00200140 predicted 494
5 SASI_Mm01_00200142 predicted 389
6 SASI_Mm01_00200143 predicted 1051
7 SASI_Mm01_00200144 predicted 575
8 SASI_Mm02_00319302 predicted 703
9 SASI_Mm02_00319303 predicted 488
10 SASI_Mm02_00319304 predicted 550
11 SASI_Mm01_00200136 predicted 546
12 SASI_Mm01_00200137 predicted 1741
13 SASI_Mm01_00200138 predicted 1560
14 SASI_Mm01_00200141 predicted 1334
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006770
MARCO MISSION shRNA Bacterial Glycerol Stock
macrophage receptor with collagenous structure
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006770.3-1568s21c1
Sequence:CCGGGGCAGATCTGGCTGGATAATGCTCGAGCATTATCCAGCCAGATCTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006770.3-166s21c1
Sequence:CCGGCTCTTGAGTGAGACCCAACAACTCGAGTTGTTGGGTCTCACTCAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006770.2-364s1c1
Sequence:CCGGCCTGGAGATGTATTTCCTCAACTCGAGTTGAGGAAATACATCTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006770.2-1436s1c1
Sequence:CCGGCGGGCTGAAGTTTACTACAGTCTCGAGACTGTAGTAAACTTCAGCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006770.2-202s1c1
Sequence:CCGGCCAAATTGCAATGGAGCCTTTCTCGAGAAAGGCTCCATTGCAATTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006770.2-557s1c1
Sequence:CCGGCCAGGGATGTTCAGAATCAAACTCGAGTTTGATTCTGAACATCCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006770.2-1404s1c1
Sequence:CCGGCCGTCAGGATTGTCGGCAGTACTCGAGTACTGCCGACAATCCTGACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006770.3-267s21c1
Sequence:CCGGCCTAGCTGTGGTGGTCATCTACTCGAGTAGATGACCACCACAGCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006770.3-1513s21c1
Sequence:CCGGCGCATGCTGGGTTACTCCAAACTCGAGTTTGGAGTAACCCAGCATGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006770
MARCO MISSION shRNA shRNA Plasmid DNA
macrophage receptor with collagenous structure
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006770.3-1568s21c1
Sequence:CCGGGGCAGATCTGGCTGGATAATGCTCGAGCATTATCCAGCCAGATCTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006770.3-166s21c1
Sequence:CCGGCTCTTGAGTGAGACCCAACAACTCGAGTTGTTGGGTCTCACTCAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006770.2-364s1c1
Sequence:CCGGCCTGGAGATGTATTTCCTCAACTCGAGTTGAGGAAATACATCTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006770.2-1436s1c1
Sequence:CCGGCGGGCTGAAGTTTACTACAGTCTCGAGACTGTAGTAAACTTCAGCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006770.2-202s1c1
Sequence:CCGGCCAAATTGCAATGGAGCCTTTCTCGAGAAAGGCTCCATTGCAATTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006770.2-557s1c1
Sequence:CCGGCCAGGGATGTTCAGAATCAAACTCGAGTTTGATTCTGAACATCCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006770.2-1404s1c1
Sequence:CCGGCCGTCAGGATTGTCGGCAGTACTCGAGTACTGCCGACAATCCTGACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006770.3-267s21c1
Sequence:CCGGCCTAGCTGTGGTGGTCATCTACTCGAGTAGATGACCACCACAGCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006770.3-1513s21c1
Sequence:CCGGCGCATGCTGGGTTACTCCAAACTCGAGTTTGGAGTAACCCAGCATGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006770
MARCO MISSION shRNA Lentiviral Transduction Particles
macrophage receptor with collagenous structure
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006770.3-1568s21c1
Sequence:CCGGGGCAGATCTGGCTGGATAATGCTCGAGCATTATCCAGCCAGATCTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006770.3-166s21c1
Sequence:CCGGCTCTTGAGTGAGACCCAACAACTCGAGTTGTTGGGTCTCACTCAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006770.2-364s1c1
Sequence:CCGGCCTGGAGATGTATTTCCTCAACTCGAGTTGAGGAAATACATCTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006770.2-1436s1c1
Sequence:CCGGCGGGCTGAAGTTTACTACAGTCTCGAGACTGTAGTAAACTTCAGCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006770.2-202s1c1
Sequence:CCGGCCAAATTGCAATGGAGCCTTTCTCGAGAAAGGCTCCATTGCAATTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006770.2-557s1c1
Sequence:CCGGCCAGGGATGTTCAGAATCAAACTCGAGTTTGATTCTGAACATCCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006770.2-1404s1c1
Sequence:CCGGCCGTCAGGATTGTCGGCAGTACTCGAGTACTGCCGACAATCCTGACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006770.3-267s21c1
Sequence:CCGGCCTAGCTGTGGTGGTCATCTACTCGAGTAGATGACCACCACAGCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006770.3-1513s21c1
Sequence:CCGGCGCATGCTGGGTTACTCCAAACTCGAGTTTGGAGTAACCCAGCATGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010766
MARCO MISSION shRNA Bacterial Glycerol Stock
macrophage receptor with collagenous structure
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010766.2-1784s21c1
Sequence:CCGGAGTTTGTGGGACTGCAGTAAGCTCGAGCTTACTGCAGTCCCACAAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010766.2-1409s21c1
Sequence:CCGGCCAGGTCTTGTAGGCAGAAAGCTCGAGCTTTCTGCCTACAAGACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010766.1-352s1c1
Sequence:CCGGCACAGAAGACAGAGCCGATTTCTCGAGAAATCGGCTCTGTCTTCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010766.1-734s1c1
Sequence:CCGGCCAGAGTTGTTCCAGATTAAACTCGAGTTTAATCTGGAACAACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010766.1-1815s1c1
Sequence:CCGGGCAATCACAATTGCGTACATACTCGAGTATGTACGCAATTGTGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010766.1-1602s1c1
Sequence:CCGGGCCGAGCTGAAGTTTACTATACTCGAGTATAGTAAACTTCAGCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010766.2-1646s21c1
Sequence:CCGGGATGATGATTGGGATAATAATCTCGAGATTATTATCCCAATCATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010766
MARCO MISSION shRNA shRNA Plasmid DNA
macrophage receptor with collagenous structure
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010766.2-1784s21c1
Sequence:CCGGAGTTTGTGGGACTGCAGTAAGCTCGAGCTTACTGCAGTCCCACAAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010766.2-1409s21c1
Sequence:CCGGCCAGGTCTTGTAGGCAGAAAGCTCGAGCTTTCTGCCTACAAGACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010766.1-352s1c1
Sequence:CCGGCACAGAAGACAGAGCCGATTTCTCGAGAAATCGGCTCTGTCTTCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010766.1-734s1c1
Sequence:CCGGCCAGAGTTGTTCCAGATTAAACTCGAGTTTAATCTGGAACAACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010766.1-1815s1c1
Sequence:CCGGGCAATCACAATTGCGTACATACTCGAGTATGTACGCAATTGTGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010766.1-1602s1c1
Sequence:CCGGGCCGAGCTGAAGTTTACTATACTCGAGTATAGTAAACTTCAGCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010766.2-1646s21c1
Sequence:CCGGGATGATGATTGGGATAATAATCTCGAGATTATTATCCCAATCATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010766
MARCO MISSION shRNA Lentiviral Transduction Particles
macrophage receptor with collagenous structure
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010766.2-1784s21c1
Sequence:CCGGAGTTTGTGGGACTGCAGTAAGCTCGAGCTTACTGCAGTCCCACAAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010766.2-1409s21c1
Sequence:CCGGCCAGGTCTTGTAGGCAGAAAGCTCGAGCTTTCTGCCTACAAGACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010766.1-352s1c1
Sequence:CCGGCACAGAAGACAGAGCCGATTTCTCGAGAAATCGGCTCTGTCTTCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010766.1-734s1c1
Sequence:CCGGCCAGAGTTGTTCCAGATTAAACTCGAGTTTAATCTGGAACAACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010766.1-1815s1c1
Sequence:CCGGGCAATCACAATTGCGTACATACTCGAGTATGTACGCAATTGTGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010766.1-1602s1c1
Sequence:CCGGGCCGAGCTGAAGTTTACTATACTCGAGTATAGTAAACTTCAGCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010766.2-1646s21c1
Sequence:CCGGGATGATGATTGGGATAATAATCTCGAGATTATTATCCCAATCATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)