EMAIL THIS PAGE TO A FRIEND

MARK1

MAP/microtubule affinity-regulating kinase 1

219 Gene Product Result for
Synonyms: MARK Par-1c Par1c
Gene ID:
Mouse(226778) MAP/microtubule affinity-regulating kinase 1
Rat(117016) MAP/microtubule affinity-regulating kinase 1
sheep(101105515) MAP/microtubule affinity-regulating kinase 1
domestic guinea pig(100716002) MAP/microtubule affinity-regulating kinase 1
naked mole-rat(101711152) MAP/microtubule affinity-regulating kinase 1
Zebrafish(100003170) MAP/microtubule affinity-regulating kinase 1
cow(539563) MAP/microtubule affinity-regulating kinase 1
Horse(100054005) MAP/microtubule affinity-regulating kinase 1
domestic cat(101099270) MAP/microtubule affinity-regulating kinase 1
dog(478965) MAP/microtubule affinity-regulating kinase 1
chicken(421342) MAP/microtubule affinity-regulating kinase 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145515 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145515 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145515 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018650 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018650 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018650 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018650 Rosetta Predictions human pricing
NM_053947 Rosetta Predictions rat pricing
NM_145515 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018650 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074444 predicted 873
2 SASI_Hs01_00074445 predicted 762
3 SASI_Hs02_00352148 predicted 2290
4 SASI_Hs02_00352149 predicted 2045
5 SASI_Hs02_00352150 predicted 899
6 SASI_Hs01_00074449 predicted 1259
7 SASI_Hs02_00352151 predicted 1724
8 SASI_Hs01_00074450 predicted 2498
9 SASI_Hs01_00074451 predicted 2361
10 SASI_Hs01_00074452 predicted 2675
11 SASI_Hs01_00074443 predicted 1465
12 SASI_Hs01_00074446 predicted 1229
13 SASI_Hs01_00074447 predicted 680
14 SASI_Hs01_00074448 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053947 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044498 predicted 498
2 SASI_Rn02_00266905 predicted 1204
3 SASI_Rn01_00044499 predicted 617
4 SASI_Rn01_00044500 predicted 2462
5 SASI_Rn01_00044501 predicted 913
6 SASI_Rn01_00044502 predicted 1079
7 SASI_Rn02_00266906 predicted 2513
8 SASI_Rn01_00044503 predicted 627
9 SASI_Rn01_00044505 predicted 1492
10 SASI_Rn01_00044506 predicted 2418
11 SASI_Rn01_00044504 predicted 463
12 SASI_Rn01_00044507 predicted 2534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145515 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199256 predicted 765
2 SASI_Mm01_00199257 predicted 350
3 SASI_Mm01_00199258 predicted 399
4 SASI_Mm01_00199259 predicted 872
5 SASI_Mm01_00199260 predicted 284
6 SASI_Mm01_00199261 predicted 2489
7 SASI_Mm01_00199262 predicted 935
8 SASI_Mm01_00199263 predicted 496
9 SASI_Mm01_00199264 predicted 972
10 SASI_Mm01_00199265 predicted 329
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145515
VALIDATED
MARK1 MISSION shRNA Bacterial Glycerol Stock
MAP/microtubule affinity-regulating kinase 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145515.2-502s21c1
Sequence:CCGGGTGAAGTCTTTGATTACTTAGCTCGAGCTAAGTAATCAAAGACTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145515.2-2384s21c1
Sequence:CCGGGGTCCGCTTCAAGCGAATATCCTCGAGGATATTCGCTTGAAGCGGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145515.2-2619s21c1
Sequence:CCGGCAAGTCAGTATGAGCTATAATCTCGAGATTATAGCTCATACTGACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145515.2-1767s21c1
Sequence:CCGGGTTACACTGCCAACCATTAAACTCGAGTTTAATGGTTGGCAGTGTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145515.2-951s21c1
Sequence:CCGGTTAGTGCTGAATCCCATAAAGCTCGAGCTTTATGGGATTCAGCACTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145515.2-1540s21c1
Sequence:CCGGGCCCAAGTAACAACGTATATTCTCGAGAATATACGTTGTTACTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145515.2-415s21c1
Sequence:CCGGTACTGAACCATCCTAACATAGCTCGAGCTATGTTAGGATGGTTCAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145515.2-2577s21c1
Sequence:CCGGCTTAATGCAATAAGGTTATACCTCGAGGTATAACCTTATTGCATTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145515.1-1467s1c1
Sequence:CCGGCGAGCCCAAGTAACAACGTATCTCGAGATACGTTGTTACTTGGGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145515.1-356s1c1
Sequence:CCGGCCTAACATAGTGAAACTGTTTCTCGAGAAACAGTTTCACTATGTTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145515.1-485s1c1
Sequence:CCGGCGTGCCAAATTCAGGCAGATTCTCGAGAATCTGCCTGAATTTGGCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145515.1-988s1c1
Sequence:CCGGGCTTGATCTCAACGATGCAAACTCGAGTTTGCATCGTTGAGATCAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145515.1-2334s1c1
Sequence:CCGGCTGGGACATCTATTGCCTTTACTCGAGTAAAGGCAATAGATGTCCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145515
VALIDATED
MARK1 MISSION shRNA shRNA Plasmid DNA
MAP/microtubule affinity-regulating kinase 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145515.2-502s21c1
Sequence:CCGGGTGAAGTCTTTGATTACTTAGCTCGAGCTAAGTAATCAAAGACTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145515.2-2384s21c1
Sequence:CCGGGGTCCGCTTCAAGCGAATATCCTCGAGGATATTCGCTTGAAGCGGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145515.2-2619s21c1
Sequence:CCGGCAAGTCAGTATGAGCTATAATCTCGAGATTATAGCTCATACTGACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145515.2-1767s21c1
Sequence:CCGGGTTACACTGCCAACCATTAAACTCGAGTTTAATGGTTGGCAGTGTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145515.2-951s21c1
Sequence:CCGGTTAGTGCTGAATCCCATAAAGCTCGAGCTTTATGGGATTCAGCACTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145515.2-1540s21c1
Sequence:CCGGGCCCAAGTAACAACGTATATTCTCGAGAATATACGTTGTTACTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145515.2-415s21c1
Sequence:CCGGTACTGAACCATCCTAACATAGCTCGAGCTATGTTAGGATGGTTCAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145515.2-2577s21c1
Sequence:CCGGCTTAATGCAATAAGGTTATACCTCGAGGTATAACCTTATTGCATTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145515.1-1467s1c1
Sequence:CCGGCGAGCCCAAGTAACAACGTATCTCGAGATACGTTGTTACTTGGGCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145515.1-356s1c1
Sequence:CCGGCCTAACATAGTGAAACTGTTTCTCGAGAAACAGTTTCACTATGTTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145515.1-485s1c1
Sequence:CCGGCGTGCCAAATTCAGGCAGATTCTCGAGAATCTGCCTGAATTTGGCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145515.1-988s1c1
Sequence:CCGGGCTTGATCTCAACGATGCAAACTCGAGTTTGCATCGTTGAGATCAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145515.1-2334s1c1
Sequence:CCGGCTGGGACATCTATTGCCTTTACTCGAGTAAAGGCAATAGATGTCCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145515
VALIDATED
MARK1 MISSION shRNA Lentiviral Transduction Particles
MAP/microtubule affinity-regulating kinase 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145515.2-502s21c1
Sequence:CCGGGTGAAGTCTTTGATTACTTAGCTCGAGCTAAGTAATCAAAGACTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145515.2-2384s21c1
Sequence:CCGGGGTCCGCTTCAAGCGAATATCCTCGAGGATATTCGCTTGAAGCGGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145515.2-2619s21c1
Sequence:CCGGCAAGTCAGTATGAGCTATAATCTCGAGATTATAGCTCATACTGACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145515.2-1767s21c1
Sequence:CCGGGTTACACTGCCAACCATTAAACTCGAGTTTAATGGTTGGCAGTGTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145515.2-951s21c1
Sequence:CCGGTTAGTGCTGAATCCCATAAAGCTCGAGCTTTATGGGATTCAGCACTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145515.2-1540s21c1
Sequence:CCGGGCCCAAGTAACAACGTATATTCTCGAGAATATACGTTGTTACTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145515.2-415s21c1
Sequence:CCGGTACTGAACCATCCTAACATAGCTCGAGCTATGTTAGGATGGTTCAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145515.2-2577s21c1
Sequence:CCGGCTTAATGCAATAAGGTTATACCTCGAGGTATAACCTTATTGCATTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145515.1-1467s1c1
Sequence:CCGGCGAGCCCAAGTAACAACGTATCTCGAGATACGTTGTTACTTGGGCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145515.1-356s1c1
Sequence:CCGGCCTAACATAGTGAAACTGTTTCTCGAGAAACAGTTTCACTATGTTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145515.1-485s1c1
Sequence:CCGGCGTGCCAAATTCAGGCAGATTCTCGAGAATCTGCCTGAATTTGGCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145515.1-988s1c1
Sequence:CCGGGCTTGATCTCAACGATGCAAACTCGAGTTTGCATCGTTGAGATCAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145515.1-2334s1c1
Sequence:CCGGCTGGGACATCTATTGCCTTTACTCGAGTAAAGGCAATAGATGTCCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018650
MARK1 MISSION shRNA Bacterial Glycerol Stock
MAP/microtubule affinity-regulating kinase 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018650.3-2265s21c1
Sequence:CCGGCACTTCTGGTCATCCTATTAACTCGAGTTAATAGGATGACCAGAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018650.2-2395s1c1
Sequence:CCGGCGACGCAGCGTTGCTTATAATCTCGAGATTATAAGCAACGCTGCGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018650.2-765s1c1
Sequence:CCGGCATTGGAAATTACCGTTTACACTCGAGTGTAAACGGTAATTTCCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018650.2-1606s1c1
Sequence:CCGGGATGAAGTTATGGCTACTTATCTCGAGATAAGTAGCCATAACTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018650.2-2471s1c1
Sequence:CCGGGAACGTCAACTGGTATAATAACTCGAGTTATTATACCAGTTGACGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018650.3-1405s21c1
Sequence:CCGGTTACGAGGGAAGTACCGTATTCTCGAGAATACGGTACTTCCCTCGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018650.3-4969s21c1
Sequence:CCGGCCACGGTAGAAACTGATATTTCTCGAGAAATATCAGTTTCTACCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018650.3-909s21c1
Sequence:CCGGATTTCGAGAAGTACGAATAATCTCGAGATTATTCGTACTTCTCGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018650.2-2974s1c1
Sequence:CCGGCCCATGTAGAATTTGCCCTTACTCGAGTAAGGGCAAATTCTACATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018650.2-1916s1c1
Sequence:CCGGGCAGCACAACAGTTGGATCAACTCGAGTTGATCCAACTGTTGTGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018650.2-1564s1c1
Sequence:CCGGGCACGAGATGAAATAAATGATCTCGAGATCATTTATTTCATCTCGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018650.2-1825s1c1
Sequence:CCGGCCTGCTGTATCATATACCAAACTCGAGTTTGGTATATGATACAGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018650.2-2586s1c1
Sequence:CCGGGCGGTTCACATGGAGTATGAACTCGAGTTCATACTCCATGTGAACCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018650.3-2287s21c1
Sequence:CCGGGTCACACTGCCAACCATTAAACTCGAGTTTAATGGTTGGCAGTGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018650
MARK1 MISSION shRNA shRNA Plasmid DNA
MAP/microtubule affinity-regulating kinase 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018650.3-2265s21c1
Sequence:CCGGCACTTCTGGTCATCCTATTAACTCGAGTTAATAGGATGACCAGAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018650.2-2395s1c1
Sequence:CCGGCGACGCAGCGTTGCTTATAATCTCGAGATTATAAGCAACGCTGCGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018650.2-765s1c1
Sequence:CCGGCATTGGAAATTACCGTTTACACTCGAGTGTAAACGGTAATTTCCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018650.2-1606s1c1
Sequence:CCGGGATGAAGTTATGGCTACTTATCTCGAGATAAGTAGCCATAACTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018650.2-2471s1c1
Sequence:CCGGGAACGTCAACTGGTATAATAACTCGAGTTATTATACCAGTTGACGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018650.3-1405s21c1
Sequence:CCGGTTACGAGGGAAGTACCGTATTCTCGAGAATACGGTACTTCCCTCGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018650.3-4969s21c1
Sequence:CCGGCCACGGTAGAAACTGATATTTCTCGAGAAATATCAGTTTCTACCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018650.3-909s21c1
Sequence:CCGGATTTCGAGAAGTACGAATAATCTCGAGATTATTCGTACTTCTCGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018650.2-2974s1c1
Sequence:CCGGCCCATGTAGAATTTGCCCTTACTCGAGTAAGGGCAAATTCTACATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018650.2-1916s1c1
Sequence:CCGGGCAGCACAACAGTTGGATCAACTCGAGTTGATCCAACTGTTGTGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018650.2-1564s1c1
Sequence:CCGGGCACGAGATGAAATAAATGATCTCGAGATCATTTATTTCATCTCGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018650.2-1825s1c1
Sequence:CCGGCCTGCTGTATCATATACCAAACTCGAGTTTGGTATATGATACAGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018650.2-2586s1c1
Sequence:CCGGGCGGTTCACATGGAGTATGAACTCGAGTTCATACTCCATGTGAACCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018650.3-2287s21c1
Sequence:CCGGGTCACACTGCCAACCATTAAACTCGAGTTTAATGGTTGGCAGTGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018650
MARK1 MISSION shRNA Lentiviral Transduction Particles
MAP/microtubule affinity-regulating kinase 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018650.3-2265s21c1
Sequence:CCGGCACTTCTGGTCATCCTATTAACTCGAGTTAATAGGATGACCAGAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018650.2-2395s1c1
Sequence:CCGGCGACGCAGCGTTGCTTATAATCTCGAGATTATAAGCAACGCTGCGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018650.2-765s1c1
Sequence:CCGGCATTGGAAATTACCGTTTACACTCGAGTGTAAACGGTAATTTCCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018650.2-1606s1c1
Sequence:CCGGGATGAAGTTATGGCTACTTATCTCGAGATAAGTAGCCATAACTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018650.2-2471s1c1
Sequence:CCGGGAACGTCAACTGGTATAATAACTCGAGTTATTATACCAGTTGACGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018650.3-1405s21c1
Sequence:CCGGTTACGAGGGAAGTACCGTATTCTCGAGAATACGGTACTTCCCTCGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018650.3-4969s21c1
Sequence:CCGGCCACGGTAGAAACTGATATTTCTCGAGAAATATCAGTTTCTACCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018650.3-909s21c1
Sequence:CCGGATTTCGAGAAGTACGAATAATCTCGAGATTATTCGTACTTCTCGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018650.2-2974s1c1
Sequence:CCGGCCCATGTAGAATTTGCCCTTACTCGAGTAAGGGCAAATTCTACATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018650.2-1916s1c1
Sequence:CCGGGCAGCACAACAGTTGGATCAACTCGAGTTGATCCAACTGTTGTGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018650.2-1564s1c1
Sequence:CCGGGCACGAGATGAAATAAATGATCTCGAGATCATTTATTTCATCTCGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018650.2-1825s1c1
Sequence:CCGGCCTGCTGTATCATATACCAAACTCGAGTTTGGTATATGATACAGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018650.2-2586s1c1
Sequence:CCGGGCGGTTCACATGGAGTATGAACTCGAGTTCATACTCCATGTGAACCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018650.3-2287s21c1
Sequence:CCGGGTCACACTGCCAACCATTAAACTCGAGTTTAATGGTTGGCAGTGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)