EMAIL THIS PAGE TO A FRIEND

MARK2

MAP/microtubule affinity-regulating kinase 2

155 Gene Product Result for
Synonyms: EMK-1 EMK1 PAR-1 Par-1b Par1b
Gene ID:
Human(2011) Summary: This gene encodes a member of the Par-1 family of serine/threonine protein kinases. The protein is an important regulator of cell polarity in epithelial and neuronal cells, and also controls the stability of microtubules through phosphorylation and inactivation of several microtubule-associating proteins. The protein localizes to cell membranes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
Mouse(13728) MAP/microtubule affinity-regulating kinase 2
Rat(60328) MAP/microtubule affinity-regulating kinase 2
cow(535197) MAP/microtubule affinity-regulating kinase 2
Horse(100049882) MAP/microtubule affinity-regulating kinase 2
domestic cat(101095375) MAP/microtubule affinity-regulating kinase 2
dog(483769) MAP/microtubule affinity-regulating kinase 2
naked mole-rat(101707850) MAP/microtubule affinity-regulating kinase 2
domestic guinea pig(100731733) MAP/microtubule affinity-regulating kinase 2
sheep(101121302) MAP/microtubule affinity-regulating kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
M4322 Anti-MARK2 (1-15) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
M4447 Anti-MARK2 (386-400) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
HPA038790 Anti-MARK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4500760 Anti-MARK2 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4500761 Anti-MARK2 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, western blot pricing
HPA074905 Anti-MARK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB2500616 Anti-MARK2/PAR-1 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, mouse, bovine, human
ELISA, western blot pricing
SAB4504258 Anti-phospho-MARK1/2/3/4 (pThr215) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry pricing
WH0002011M1 Monoclonal Anti-MARK2 antibody produced in mouse clone 3B12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403768 Monoclonal Anti-MARK2 antibody produced in mouse clone 3C5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004954 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004954 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004954 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007928 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007928 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007928 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039468 Rosetta Predictions human pricing
NM_001039469 Rosetta Predictions human pricing
NM_004954 Rosetta Predictions human pricing
NM_017490 Rosetta Predictions human pricing
NM_021699 Rosetta Predictions rat pricing
NM_001080388 Rosetta Predictions mouse pricing
NM_001080389 Rosetta Predictions mouse pricing
NM_001080390 Rosetta Predictions mouse pricing
NM_007928 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017634 predicted 541
2 SASI_Hs01_00017635 predicted 473
3 SASI_Hs01_00017636 predicted 371
4 SASI_Hs01_00017637 predicted 733
5 SASI_Hs01_00017638 predicted 991
6 SASI_Hs01_00017639 predicted 876
7 SASI_Hs01_00017640 predicted 776
8 SASI_Hs01_00017642 predicted 584
9 SASI_Hs01_00017643 predicted 787
10 SASI_Hs02_00308520 predicted 458
11 SASI_Hs01_00017641 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085483 predicted 403
2 SASI_Hs01_00085484 predicted 336
3 SASI_Hs01_00085485 predicted 234
4 SASI_Hs01_00085486 predicted 593
5 SASI_Hs01_00085487 predicted 853
6 SASI_Hs01_00085488 predicted 738
7 SASI_Hs01_00085489 predicted 641
8 SASI_Hs01_00085491 predicted 447
9 SASI_Hs01_00085492 predicted 653
10 SASI_Hs02_00308521 predicted 318
11 SASI_Hs01_00085490 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077142 predicted 758
2 SASI_Hs01_00077143 predicted 698
3 SASI_Hs01_00077144 predicted 587
4 SASI_Hs01_00077145 predicted 951
5 SASI_Hs01_00077146 predicted 1208
6 SASI_Hs01_00077147 predicted 1108
7 SASI_Hs01_00077148 predicted 998
8 SASI_Hs01_00077150 predicted 810
9 SASI_Hs01_00077151 predicted 1015
10 SASI_Hs02_00338632 predicted 683
11 SASI_Hs01_00077149 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057033 predicted 756
2 SASI_Hs01_00057034 predicted 694
3 SASI_Hs01_00057035 predicted 596
4 SASI_Hs01_00057036 predicted 960
5 SASI_Hs01_00057037 predicted 1209
6 SASI_Hs01_00057038 predicted 1105
7 SASI_Hs01_00057039 predicted 1000
8 SASI_Hs01_00057041 predicted 805
9 SASI_Hs01_00057042 predicted 1012
10 SASI_Hs02_00350097 predicted 678
11 SASI_Hs01_00057040 predicted 796
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021699 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098509 predicted 912
2 SASI_Rn01_00098510 predicted 933
3 SASI_Rn01_00098511 predicted 1766
4 SASI_Rn01_00098512 predicted 359
5 SASI_Rn01_00098513 predicted 532
6 SASI_Rn01_00098514 predicted 828
7 SASI_Rn01_00098515 predicted 870
8 SASI_Rn02_00262742 predicted 1015
9 SASI_Rn02_00262743 predicted 649
10 SASI_Rn02_00262744 predicted 2109
11 SASI_Rn01_00098508 predicted 601
12 SASI_Rn01_00098516 predicted 500
13 SASI_Rn01_00098517 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080388 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293433 predicted 1493
2 SASI_Mm02_00293434 predicted 1415
3 SASI_Mm02_00293435 predicted 1082
4 SASI_Mm02_00293436 predicted 951
5 SASI_Mm02_00293437 predicted 1608
6 SASI_Mm02_00293438 predicted 1124
7 SASI_Mm02_00293439 predicted 1422
8 SASI_Mm02_00293440 predicted 1482
9 SASI_Mm02_00293441 predicted 943
10 SASI_Mm02_00293442 predicted 2699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080389 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293443 predicted 1500
2 SASI_Mm02_00293444 predicted 1415
3 SASI_Mm02_00293445 predicted 1081
4 SASI_Mm02_00293446 predicted 951
5 SASI_Mm02_00293447 predicted 1606
6 SASI_Mm02_00293448 predicted 1127
7 SASI_Mm02_00293449 predicted 1428
8 SASI_Mm02_00293450 predicted 1481
9 SASI_Mm02_00293451 predicted 944
10 SASI_Mm02_00293452 predicted 2719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080390 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293453 predicted 1223
2 SASI_Mm02_00293454 predicted 1143
3 SASI_Mm02_00293455 predicted 798
4 SASI_Mm02_00293456 predicted 675
5 SASI_Mm02_00293457 predicted 1330
6 SASI_Mm02_00293458 predicted 847
7 SASI_Mm02_00293459 predicted 1148
8 SASI_Mm02_00293460 predicted 1205
9 SASI_Mm02_00293461 predicted 666
10 SASI_Mm02_00293462 predicted 2583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007928 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061309 predicted 1499
2 SASI_Mm01_00061310 predicted 1422
3 SASI_Mm01_00061311 predicted 2515
4 SASI_Mm02_00312763 predicted 1960
5 SASI_Mm01_00061312 predicted 945
6 SASI_Mm01_00061313 predicted 1605
7 SASI_Mm01_00061314 predicted 1122
8 SASI_Mm01_00061315 predicted 1423
9 SASI_Mm01_00061316 predicted 1480
10 SASI_Mm01_00061317 predicted 942
11 SASI_Mm01_00061318 predicted 2325
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004954
VALIDATED
MARK2 MISSION shRNA Bacterial Glycerol Stock
MAP/microtubule affinity-regulating kinase 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004954.x-2736s1c1
Sequence:CCGGTGCACAGAGTATTTCGCCTAACTCGAGTTAGGCGAAATACTCTGTGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004954.x-807s1c1
Sequence:CCGGCACCAGAAGTTTATTGTCCATCTCGAGATGGACAATAAACTTCTGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004954.x-1235s1c1
Sequence:CCGGAGATGATGAACTAAAGCCTTACTCGAGTAAGGCTTTAGTTCATCATCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004954.x-1312s1c1
Sequence:CCGGTGGGTTATACACGGGAAGAGACTCGAGTCTCTTCCCGTGTATAACCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004954.x-706s1c1
Sequence:CCGGGTGGCGGAGAGGTATTTGATTCTCGAGAATCAAATACCTCTCCGCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004954.4-1821s21c1
Sequence:GTACCGGTGCCATTCCCACCTCTAATTCCTCGAGGAATTAGAGGTGGGAATGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004954.3-1235s21c1
Sequence:CCGGAGATGATGAACTAAAGCCTTACTCGAGTAAGGCTTTAGTTCATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004954.3-706s21c1
Sequence:CCGGGTGGCGGAGAGGTATTTGATTCTCGAGAATCAAATACCTCTCCGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004954.3-1300s21c1
Sequence:CCGGTGATGGTGTCCATGGGTTATACTCGAGTATAACCCATGGACACCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004954.3-2738s21c1
Sequence:CCGGTGCACAGAGTATTTCGCCTAACTCGAGTTAGGCGAAATACTCTGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004954.3-479s21c1
Sequence:CCGGGACCATTGGCAAGGGTAATTTCTCGAGAAATTACCCTTGCCAATGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004954
VALIDATED
MARK2 MISSION shRNA shRNA Plasmid DNA
MAP/microtubule affinity-regulating kinase 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004954.x-2736s1c1
Sequence:CCGGTGCACAGAGTATTTCGCCTAACTCGAGTTAGGCGAAATACTCTGTGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004954.x-807s1c1
Sequence:CCGGCACCAGAAGTTTATTGTCCATCTCGAGATGGACAATAAACTTCTGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004954.x-1235s1c1
Sequence:CCGGAGATGATGAACTAAAGCCTTACTCGAGTAAGGCTTTAGTTCATCATCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004954.x-1312s1c1
Sequence:CCGGTGGGTTATACACGGGAAGAGACTCGAGTCTCTTCCCGTGTATAACCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004954.x-706s1c1
Sequence:CCGGGTGGCGGAGAGGTATTTGATTCTCGAGAATCAAATACCTCTCCGCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004954.4-1821s21c1
Sequence:GTACCGGTGCCATTCCCACCTCTAATTCCTCGAGGAATTAGAGGTGGGAATGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004954.3-1235s21c1
Sequence:CCGGAGATGATGAACTAAAGCCTTACTCGAGTAAGGCTTTAGTTCATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004954.3-706s21c1
Sequence:CCGGGTGGCGGAGAGGTATTTGATTCTCGAGAATCAAATACCTCTCCGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004954.3-1300s21c1
Sequence:CCGGTGATGGTGTCCATGGGTTATACTCGAGTATAACCCATGGACACCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004954.3-2738s21c1
Sequence:CCGGTGCACAGAGTATTTCGCCTAACTCGAGTTAGGCGAAATACTCTGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004954.3-479s21c1
Sequence:CCGGGACCATTGGCAAGGGTAATTTCTCGAGAAATTACCCTTGCCAATGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004954
VALIDATED
MARK2 MISSION shRNA Lentiviral Transduction Particles
MAP/microtubule affinity-regulating kinase 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001581    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004954.x-2736s1c1
Sequence:CCGGTGCACAGAGTATTTCGCCTAACTCGAGTTAGGCGAAATACTCTGTGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004954.x-807s1c1
Sequence:CCGGCACCAGAAGTTTATTGTCCATCTCGAGATGGACAATAAACTTCTGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004954.x-1235s1c1
Sequence:CCGGAGATGATGAACTAAAGCCTTACTCGAGTAAGGCTTTAGTTCATCATCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004954.x-1312s1c1
Sequence:CCGGTGGGTTATACACGGGAAGAGACTCGAGTCTCTTCCCGTGTATAACCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004954.x-706s1c1
Sequence:CCGGGTGGCGGAGAGGTATTTGATTCTCGAGAATCAAATACCTCTCCGCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004954.4-1821s21c1
Sequence:GTACCGGTGCCATTCCCACCTCTAATTCCTCGAGGAATTAGAGGTGGGAATGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004954.3-1235s21c1
Sequence:CCGGAGATGATGAACTAAAGCCTTACTCGAGTAAGGCTTTAGTTCATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004954.3-706s21c1
Sequence:CCGGGTGGCGGAGAGGTATTTGATTCTCGAGAATCAAATACCTCTCCGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004954.3-1300s21c1
Sequence:CCGGTGATGGTGTCCATGGGTTATACTCGAGTATAACCCATGGACACCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004954.3-2738s21c1
Sequence:CCGGTGCACAGAGTATTTCGCCTAACTCGAGTTAGGCGAAATACTCTGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004954.3-479s21c1
Sequence:CCGGGACCATTGGCAAGGGTAATTTCTCGAGAAATTACCCTTGCCAATGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007928
VALIDATED
MARK2 MISSION shRNA Bacterial Glycerol Stock
MAP/microtubule affinity-regulating kinase 2
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007928.1-1190s1c1
Sequence:CCGGCGGAAGGTGATACCATCACTTCTCGAGAAGTGATGGTATCACCTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007928.1-550s1c1
Sequence:CCGGCGAGCCAAATTTCGCCAGATACTCGAGTATCTGGCGAAATTTGGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007928.1-2016s1c1
Sequence:CCGGCCTGAATGAACCTGAAAGCAACTCGAGTTGCTTTCAGGTTCATTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007928.1-1131s1c1
Sequence:CCGGCCAGAGGTACAACGAAGTGATCTCGAGATCACTTCGTTGTACCTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007928.1-421s1c1
Sequence:CCGGCCCAACATAGTTAAGTTGTTTCTCGAGAAACAACTTAACTATGTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007928.2-1476s21c1
Sequence:CCGGCTCATACTTAATCCTAGTAAGCTCGAGCTTACTAGGATTAAGTATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007928.2-3238s21c1
Sequence:CCGGTGCGGTTGCACAGAGTATTTCCTCGAGGAAATACTCTGTGCAACCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007928.2-2865s21c1
Sequence:CCGGCTCAACGGTGTTCGGTTTAAGCTCGAGCTTAAACCGAACACCGTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007928.2-1499s21c1
Sequence:CCGGAGGCACTTTAGAGCAAATTATCTCGAGATAATTTGCTCTAAAGTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007928.2-1544s21c1
Sequence:CCGGGCATGAGGACGATGAGCTAAACTCGAGTTTAGCTCATCGTCCTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007928.2-1081s21c1
Sequence:CCGGGAGCCAAATTTCGCCAGATAGCTCGAGCTATCTGGCGAAATTTGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007928.2-3027s21c1
Sequence:CCGGGAGAAACTGCAGGATGAATTGCTCGAGCAATTCATCCTGCAGTTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007928.2-1230s21c1
Sequence:CCGGGGGAACAAGCTGGATACTTTCCTCGAGGAAAGTATCCAGCTTGTTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007928
VALIDATED
MARK2 MISSION shRNA shRNA Plasmid DNA
MAP/microtubule affinity-regulating kinase 2
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007928.1-1190s1c1
Sequence:CCGGCGGAAGGTGATACCATCACTTCTCGAGAAGTGATGGTATCACCTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007928.1-550s1c1
Sequence:CCGGCGAGCCAAATTTCGCCAGATACTCGAGTATCTGGCGAAATTTGGCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007928.1-2016s1c1
Sequence:CCGGCCTGAATGAACCTGAAAGCAACTCGAGTTGCTTTCAGGTTCATTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007928.1-1131s1c1
Sequence:CCGGCCAGAGGTACAACGAAGTGATCTCGAGATCACTTCGTTGTACCTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007928.1-421s1c1
Sequence:CCGGCCCAACATAGTTAAGTTGTTTCTCGAGAAACAACTTAACTATGTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007928.2-1476s21c1
Sequence:CCGGCTCATACTTAATCCTAGTAAGCTCGAGCTTACTAGGATTAAGTATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007928.2-3238s21c1
Sequence:CCGGTGCGGTTGCACAGAGTATTTCCTCGAGGAAATACTCTGTGCAACCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007928.2-2865s21c1
Sequence:CCGGCTCAACGGTGTTCGGTTTAAGCTCGAGCTTAAACCGAACACCGTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007928.2-1499s21c1
Sequence:CCGGAGGCACTTTAGAGCAAATTATCTCGAGATAATTTGCTCTAAAGTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007928.2-1544s21c1
Sequence:CCGGGCATGAGGACGATGAGCTAAACTCGAGTTTAGCTCATCGTCCTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007928.2-1081s21c1
Sequence:CCGGGAGCCAAATTTCGCCAGATAGCTCGAGCTATCTGGCGAAATTTGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007928.2-3027s21c1
Sequence:CCGGGAGAAACTGCAGGATGAATTGCTCGAGCAATTCATCCTGCAGTTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007928.2-1230s21c1
Sequence:CCGGGGGAACAAGCTGGATACTTTCCTCGAGGAAAGTATCCAGCTTGTTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007928
VALIDATED
MARK2 MISSION shRNA Lentiviral Transduction Particles
MAP/microtubule affinity-regulating kinase 2
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007928.1-1190s1c1
Sequence:CCGGCGGAAGGTGATACCATCACTTCTCGAGAAGTGATGGTATCACCTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007928.1-550s1c1
Sequence:CCGGCGAGCCAAATTTCGCCAGATACTCGAGTATCTGGCGAAATTTGGCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007928.1-2016s1c1
Sequence:CCGGCCTGAATGAACCTGAAAGCAACTCGAGTTGCTTTCAGGTTCATTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007928.1-1131s1c1
Sequence:CCGGCCAGAGGTACAACGAAGTGATCTCGAGATCACTTCGTTGTACCTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007928.1-421s1c1
Sequence:CCGGCCCAACATAGTTAAGTTGTTTCTCGAGAAACAACTTAACTATGTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007928.2-1476s21c1
Sequence:CCGGCTCATACTTAATCCTAGTAAGCTCGAGCTTACTAGGATTAAGTATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007928.2-3238s21c1
Sequence:CCGGTGCGGTTGCACAGAGTATTTCCTCGAGGAAATACTCTGTGCAACCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007928.2-2865s21c1
Sequence:CCGGCTCAACGGTGTTCGGTTTAAGCTCGAGCTTAAACCGAACACCGTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007928.2-1499s21c1
Sequence:CCGGAGGCACTTTAGAGCAAATTATCTCGAGATAATTTGCTCTAAAGTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007928.2-1544s21c1
Sequence:CCGGGCATGAGGACGATGAGCTAAACTCGAGTTTAGCTCATCGTCCTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007928.2-1081s21c1
Sequence:CCGGGAGCCAAATTTCGCCAGATAGCTCGAGCTATCTGGCGAAATTTGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007928.2-3027s21c1
Sequence:CCGGGAGAAACTGCAGGATGAATTGCTCGAGCAATTCATCCTGCAGTTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007928.2-1230s21c1
Sequence:CCGGGGGAACAAGCTGGATACTTTCCTCGAGGAAAGTATCCAGCTTGTTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)