EMAIL THIS PAGE TO A FRIEND

MARK2P10

MAP/microtubule affinity-regulating kinase 2 pseudogene 10

Gene Product Result for
Species: Human MARK2P10(402679)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_380022
MARK2P10 MISSION shRNA Bacterial Glycerol Stock
MAP/microtubule affinity-regulating kinase 2 pseudogene 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380022.4-27s1c1
Sequence:CCGGGTTACTCTGCAGAGCCTTAAACTCGAGTTTAAGGCTCTGCAGAGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380022.4-298s1c1
Sequence:CCGGGAGGATGAATTAAAGCCTTATCTCGAGATAAGGCTTTAATTCATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380022.4-429s1c1
Sequence:CCGGCCCATTCTGCGAGATACAATACTCGAGTATTGTATCTCGCAGAATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380022.4-499s1c1
Sequence:CCGGCCCACCTTTCATTATTCTAAGCTCGAGCTTAGAATAATGAAAGGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380022.2-50s1c1
Sequence:CCGGCCACTCTTACATTGTGGGACACTCGAGTGTCCCACAATGTAAGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380022.2-557s1c1
Sequence:CCGGAGAGAAGATCACAACCTTCAACTCGAGTTGAAGGTTGTGATCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380022.2-268s1c1
Sequence:CCGGCTATGCTGTGAGGATGAATTACTCGAGTAATTCATCCTCACAGCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380022.2-441s1c1
Sequence:CCGGCAACCGAAAGCAGCAGAGTTTCTCGAGAAACTCTGCTGCTTTCGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380022.2-108s1c1
Sequence:CCGGGATCATCCTGACAGCAGATTTCTCGAGAAATCTGCTGTCAGGATGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_380022
MARK2P10 MISSION shRNA shRNA Plasmid DNA
MAP/microtubule affinity-regulating kinase 2 pseudogene 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380022.4-27s1c1
Sequence:CCGGGTTACTCTGCAGAGCCTTAAACTCGAGTTTAAGGCTCTGCAGAGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380022.4-298s1c1
Sequence:CCGGGAGGATGAATTAAAGCCTTATCTCGAGATAAGGCTTTAATTCATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380022.4-429s1c1
Sequence:CCGGCCCATTCTGCGAGATACAATACTCGAGTATTGTATCTCGCAGAATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380022.4-499s1c1
Sequence:CCGGCCCACCTTTCATTATTCTAAGCTCGAGCTTAGAATAATGAAAGGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380022.2-50s1c1
Sequence:CCGGCCACTCTTACATTGTGGGACACTCGAGTGTCCCACAATGTAAGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380022.2-557s1c1
Sequence:CCGGAGAGAAGATCACAACCTTCAACTCGAGTTGAAGGTTGTGATCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380022.2-268s1c1
Sequence:CCGGCTATGCTGTGAGGATGAATTACTCGAGTAATTCATCCTCACAGCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380022.2-441s1c1
Sequence:CCGGCAACCGAAAGCAGCAGAGTTTCTCGAGAAACTCTGCTGCTTTCGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380022.2-108s1c1
Sequence:CCGGGATCATCCTGACAGCAGATTTCTCGAGAAATCTGCTGTCAGGATGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_380022
MARK2P10 MISSION shRNA Lentiviral Transduction Particles
MAP/microtubule affinity-regulating kinase 2 pseudogene 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380022.4-27s1c1
Sequence:CCGGGTTACTCTGCAGAGCCTTAAACTCGAGTTTAAGGCTCTGCAGAGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380022.4-298s1c1
Sequence:CCGGGAGGATGAATTAAAGCCTTATCTCGAGATAAGGCTTTAATTCATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380022.4-429s1c1
Sequence:CCGGCCCATTCTGCGAGATACAATACTCGAGTATTGTATCTCGCAGAATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380022.4-499s1c1
Sequence:CCGGCCCACCTTTCATTATTCTAAGCTCGAGCTTAGAATAATGAAAGGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380022.2-50s1c1
Sequence:CCGGCCACTCTTACATTGTGGGACACTCGAGTGTCCCACAATGTAAGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380022.2-557s1c1
Sequence:CCGGAGAGAAGATCACAACCTTCAACTCGAGTTGAAGGTTGTGATCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380022.2-268s1c1
Sequence:CCGGCTATGCTGTGAGGATGAATTACTCGAGTAATTCATCCTCACAGCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380022.2-441s1c1
Sequence:CCGGCAACCGAAAGCAGCAGAGTTTCTCGAGAAACTCTGCTGCTTTCGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380022.2-108s1c1
Sequence:CCGGGATCATCCTGACAGCAGATTTCTCGAGAAATCTGCTGTCAGGATGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_377958
MARK2P10 MISSION shRNA Bacterial Glycerol Stock
MAP/microtubule affinity-regulating kinase 2 pseudogene 10
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377958.2-137s1c1
Sequence:CCGGGCAATGAGTTCACCTTGACAACTCGAGTTGTCAAGGTGAACTCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377958.2-416s1c1
Sequence:CCGGGCGAGATACAATATAGCGACTCTCGAGAGTCGCTATATTGTATCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377958.2-503s1c1
Sequence:CCGGGTCTAGGTAACAACTCAGAAACTCGAGTTTCTGAGTTGTTACCTAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377958.2-277s1c1
Sequence:CCGGGAGGATGAATTAAAGCCTTATCTCGAGATAAGGCTTTAATTCATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377958.2-304s1c1
Sequence:CCGGCCACTCTGTGACTACAAGGATCTCGAGATCCTTGTAGTCACAGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_377958
MARK2P10 MISSION shRNA shRNA Plasmid DNA
MAP/microtubule affinity-regulating kinase 2 pseudogene 10
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377958.2-137s1c1
Sequence:CCGGGCAATGAGTTCACCTTGACAACTCGAGTTGTCAAGGTGAACTCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377958.2-416s1c1
Sequence:CCGGGCGAGATACAATATAGCGACTCTCGAGAGTCGCTATATTGTATCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377958.2-503s1c1
Sequence:CCGGGTCTAGGTAACAACTCAGAAACTCGAGTTTCTGAGTTGTTACCTAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377958.2-277s1c1
Sequence:CCGGGAGGATGAATTAAAGCCTTATCTCGAGATAAGGCTTTAATTCATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377958.2-304s1c1
Sequence:CCGGCCACTCTGTGACTACAAGGATCTCGAGATCCTTGTAGTCACAGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_377958
MARK2P10 MISSION shRNA Lentiviral Transduction Particles
MAP/microtubule affinity-regulating kinase 2 pseudogene 10
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377958.2-137s1c1
Sequence:CCGGGCAATGAGTTCACCTTGACAACTCGAGTTGTCAAGGTGAACTCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377958.2-416s1c1
Sequence:CCGGGCGAGATACAATATAGCGACTCTCGAGAGTCGCTATATTGTATCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377958.2-503s1c1
Sequence:CCGGGTCTAGGTAACAACTCAGAAACTCGAGTTTCTGAGTTGTTACCTAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377958.2-277s1c1
Sequence:CCGGGAGGATGAATTAAAGCCTTATCTCGAGATAAGGCTTTAATTCATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377958.2-304s1c1
Sequence:CCGGCCACTCTGTGACTACAAGGATCTCGAGATCCTTGTAGTCACAGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)