EMAIL THIS PAGE TO A FRIEND

MARK3

MAP/microtubule affinity-regulating kinase 3

106 Gene Product Result for
Synonyms: CTAK1 KP78 PAR1A Par-1a
Gene ID:
Human(4140) Summary: The protein encoded by this gene is activated by phosphorylation and in turn is involved in the phosphorylation of tau proteins MAP2 and MAP4. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(17169) MAP/microtubule affinity-regulating kinase 3
Rat(170577) MAP/microtubule affinity-regulating kinase 3
Zebrafish(334300) MAP/microtubule affinity-regulating kinase 3
cow(534872) MAP/microtubule affinity-regulating kinase 3
Horse(100059464) MAP/microtubule affinity-regulating kinase 3
domestic cat(101085385) MAP/microtubule affinity-regulating kinase 3
dog(611285) MAP/microtubule affinity-regulating kinase 3
chicken(423480) MAP/microtubule affinity-regulating kinase 3
sheep(101105030) MAP/microtubule affinity-regulating kinase 3
domestic guinea pig(100721951) MAP/microtubule affinity-regulating kinase 3
naked mole-rat(101713017) MAP/microtubule affinity-regulating kinase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002376 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002376 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002376 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022801 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022801 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022801 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU093021 MISSION® esiRNA esiRNA human MARK3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002376 siRNAs that have been validated in the lab human pricing
NM_130749 Rosetta Predictions rat pricing
NM_021516 Rosetta Predictions mouse pricing
NM_022801 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002376 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071584 validated 2016
2 SASI_Hs02_00333714 predicted 1404
3 SASI_Hs01_00071583 predicted 2146
4 SASI_Hs01_00071585 predicted 1061
5 SASI_Hs02_00333715 predicted 1091
6 SASI_Hs01_00071587 predicted 2038
7 SASI_Hs01_00071588 predicted 938
8 SASI_Hs02_00333716 predicted 930
9 SASI_Hs01_00071589 predicted 977
10 SASI_Hs01_00071591 predicted 756
11 SASI_Hs01_00071592 predicted 2133
12 SASI_Hs01_00071586 predicted 2800
13 SASI_Hs01_00071590 predicted 2565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130749 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267483 predicted 544
2 SASI_Rn01_00060685 predicted 688
3 SASI_Rn02_00267484 predicted 2458
4 SASI_Rn01_00060686 predicted 1306
5 SASI_Rn01_00060687 predicted 1773
6 SASI_Rn01_00060688 predicted 794
7 SASI_Rn01_00060689 predicted 1494
8 SASI_Rn01_00060691 predicted 1629
9 SASI_Rn01_00060692 predicted 2244
10 SASI_Rn01_00060693 predicted 1101
11 SASI_Rn01_00060690 predicted 1226
12 SASI_Rn01_00060694 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021516 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141534 predicted 1226
2 SASI_Mm01_00141535 predicted 2320
3 SASI_Mm01_00141538 predicted 2382
4 SASI_Mm02_00326240 predicted 499
5 SASI_Mm01_00141539 predicted 696
6 SASI_Mm02_00326241 predicted 2294
7 SASI_Mm01_00141540 predicted 2223
8 SASI_Mm01_00141542 predicted 1312
9 SASI_Mm01_00141543 predicted 1498
10 SASI_Mm02_00326242 predicted 1295
11 SASI_Mm01_00141536 predicted 2313
12 SASI_Mm01_00141537 predicted 1676
13 SASI_Mm01_00141541 predicted 1051
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022801 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153708 predicted 1230
2 SASI_Mm01_00153709 predicted 2281
3 SASI_Mm01_00153712 predicted 2333
4 SASI_Mm02_00326645 predicted 501
5 SASI_Mm01_00153713 predicted 694
6 SASI_Mm02_00326646 predicted 2256
7 SASI_Mm01_00153714 predicted 2177
8 SASI_Mm01_00153716 predicted 1309
9 SASI_Mm01_00153717 predicted 1497
10 SASI_Mm02_00326647 predicted 1295
11 SASI_Mm01_00153710 predicted 2262
12 SASI_Mm01_00153711 predicted 1677
13 SASI_Mm01_00153715 predicted 1051
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002376
VALIDATED
MARK3 MISSION shRNA Bacterial Glycerol Stock
MAP/microtubule affinity-regulating kinase 3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002376.4-1200s1c1
Sequence:CCGGGAATTTACTGTTGGCGGTAAACTCGAGTTTACCGCCAACAGTAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002376.4-2443s1c1
Sequence:CCGGGCAATGTATCTGCTGAGCAAACTCGAGTTTGCTCAGCAGATACATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002376.4-1155s1c1
Sequence:CCGGGATGCCGATATGAACATTAAACTCGAGTTTAATGTTCATATCGGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195063    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002376.4-3215s1c1
Sequence:CCGGCCTTAAGACCAGTTCATAGTTCTCGAGAACTATGAACTGGTCTTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002376.x-1616s1c1
Sequence:CCGGCCAGTTCTAGCAGCAATCTTTCTCGAGAAAGATTGCTGCTAGAACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002376.x-823s1c1
Sequence:CCGGCATCCCAATATAGTGAAGTTACTCGAGTAACTTCACTATATTGGGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002376.x-2970s1c1
Sequence:CCGGTGTGTGTGAAGTGGTGTATATCTCGAGATATACACCACTTCACACACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002376.x-1363s1c1
Sequence:CCGGCCAATTAAACGCGGCACTCTACTCGAGTAGAGTGCCGCGTTTAATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002376.x-518s1c1
Sequence:CCGGTGAATGAACGAGACACTGAAACTCGAGTTTCAGTGTCTCGTTCATTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002376.5-2165s21c1
Sequence:CCGGGTGGAATGACACGACGAAATACTCGAGTATTTCGTCGTGTCATTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002376.5-1078s21c1
Sequence:CCGGGGTGAAGTATTTGACTATTTGCTCGAGCAAATAGTCAAATACTTCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002376.5-2096s21c1
Sequence:CCGGATCCTAATAAGGCGGATATTCCTCGAGGAATATCCGCCTTATTAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002376.5-2645s21c1
Sequence:CCGGACGCCAATAACTGCGACTATGCTCGAGCATAGTCGCAGTTATTGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002376
VALIDATED
MARK3 MISSION shRNA shRNA Plasmid DNA
MAP/microtubule affinity-regulating kinase 3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002376.4-1200s1c1
Sequence:CCGGGAATTTACTGTTGGCGGTAAACTCGAGTTTACCGCCAACAGTAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002376.4-2443s1c1
Sequence:CCGGGCAATGTATCTGCTGAGCAAACTCGAGTTTGCTCAGCAGATACATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002376.4-1155s1c1
Sequence:CCGGGATGCCGATATGAACATTAAACTCGAGTTTAATGTTCATATCGGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195063    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002376.4-3215s1c1
Sequence:CCGGCCTTAAGACCAGTTCATAGTTCTCGAGAACTATGAACTGGTCTTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002376.x-1616s1c1
Sequence:CCGGCCAGTTCTAGCAGCAATCTTTCTCGAGAAAGATTGCTGCTAGAACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002376.x-823s1c1
Sequence:CCGGCATCCCAATATAGTGAAGTTACTCGAGTAACTTCACTATATTGGGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002376.x-2970s1c1
Sequence:CCGGTGTGTGTGAAGTGGTGTATATCTCGAGATATACACCACTTCACACACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002376.x-1363s1c1
Sequence:CCGGCCAATTAAACGCGGCACTCTACTCGAGTAGAGTGCCGCGTTTAATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002376.x-518s1c1
Sequence:CCGGTGAATGAACGAGACACTGAAACTCGAGTTTCAGTGTCTCGTTCATTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002376.5-2165s21c1
Sequence:CCGGGTGGAATGACACGACGAAATACTCGAGTATTTCGTCGTGTCATTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002376.5-1078s21c1
Sequence:CCGGGGTGAAGTATTTGACTATTTGCTCGAGCAAATAGTCAAATACTTCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002376.5-2096s21c1
Sequence:CCGGATCCTAATAAGGCGGATATTCCTCGAGGAATATCCGCCTTATTAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002376.5-2645s21c1
Sequence:CCGGACGCCAATAACTGCGACTATGCTCGAGCATAGTCGCAGTTATTGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002376
VALIDATED
MARK3 MISSION shRNA Lentiviral Transduction Particles
MAP/microtubule affinity-regulating kinase 3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002376.4-1200s1c1
Sequence:CCGGGAATTTACTGTTGGCGGTAAACTCGAGTTTACCGCCAACAGTAAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002376.4-2443s1c1
Sequence:CCGGGCAATGTATCTGCTGAGCAAACTCGAGTTTGCTCAGCAGATACATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002376.4-1155s1c1
Sequence:CCGGGATGCCGATATGAACATTAAACTCGAGTTTAATGTTCATATCGGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195063    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002376.4-3215s1c1
Sequence:CCGGCCTTAAGACCAGTTCATAGTTCTCGAGAACTATGAACTGGTCTTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002376.x-1616s1c1
Sequence:CCGGCCAGTTCTAGCAGCAATCTTTCTCGAGAAAGATTGCTGCTAGAACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002376.x-823s1c1
Sequence:CCGGCATCCCAATATAGTGAAGTTACTCGAGTAACTTCACTATATTGGGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002376.x-2970s1c1
Sequence:CCGGTGTGTGTGAAGTGGTGTATATCTCGAGATATACACCACTTCACACACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002376.x-1363s1c1
Sequence:CCGGCCAATTAAACGCGGCACTCTACTCGAGTAGAGTGCCGCGTTTAATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002376.x-518s1c1
Sequence:CCGGTGAATGAACGAGACACTGAAACTCGAGTTTCAGTGTCTCGTTCATTCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002376.5-2165s21c1
Sequence:CCGGGTGGAATGACACGACGAAATACTCGAGTATTTCGTCGTGTCATTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002376.5-1078s21c1
Sequence:CCGGGGTGAAGTATTTGACTATTTGCTCGAGCAAATAGTCAAATACTTCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002376.5-2096s21c1
Sequence:CCGGATCCTAATAAGGCGGATATTCCTCGAGGAATATCCGCCTTATTAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002376.5-2645s21c1
Sequence:CCGGACGCCAATAACTGCGACTATGCTCGAGCATAGTCGCAGTTATTGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022801
VALIDATED
MARK3 MISSION shRNA Bacterial Glycerol Stock
MAP/microtubule affinity-regulating kinase 3
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022801.1-555s1c1
Sequence:CCGGGCTAAGTTTAGACAGATTGTTCTCGAGAACAATCTGTCTAAACTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022801.1-887s1c1
Sequence:CCGGCGGGAAGTACAGAATCCCTTTCTCGAGAAAGGGATTCTGTACTTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022801.1-245s1c1
Sequence:CCGGCGGAAACTACAGACTGTTGAACTCGAGTTCAACAGTCTGTAGTTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022801.1-1251s1c1
Sequence:CCGGCCAAACAGTGACCTCAGCAATCTCGAGATTGCTGAGGTCACTGTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022801.1-1672s1c1
Sequence:CCGGGCGCTATTCCAGATGAGAGAACTCGAGTTCTCTCATCTGGAATAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022801.4-1543s21c1
Sequence:CCGGTATGGTGGGAATGGGATATTCCTCGAGGAATATCCCATTCCCACCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022801.4-2253s21c1
Sequence:CCGGAGCGGCGAACCGCAACATATACTCGAGTATATGTTGCGGTTCGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022801.4-2731s21c1
Sequence:CCGGACCCAGTAATTATGGTGTAAACTCGAGTTTACACCATAATTACTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022801.4-3149s21c1
Sequence:CCGGACCTTAAGGCTAGTTGATAATCTCGAGATTATCAACTAGCCTTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022801.4-2800s21c1
Sequence:CCGGGAGTAATATTTAGGCAATAACCTCGAGGTTATTGCCTAAATATTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022801.4-2642s21c1
Sequence:CCGGCTGAATGGAGTCCGGTTTAAGCTCGAGCTTAAACCGGACTCCATTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022801.4-773s21c1
Sequence:CCGGACAGGCCGAGAGGTTGCAATACTCGAGTATTGCAACCTCTCGGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022801.4-1090s21c1
Sequence:CCGGTCTGTTATTAGATGCGGATATCTCGAGATATCCGCATCTAATAACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022801
VALIDATED
MARK3 MISSION shRNA shRNA Plasmid DNA
MAP/microtubule affinity-regulating kinase 3
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022801.1-555s1c1
Sequence:CCGGGCTAAGTTTAGACAGATTGTTCTCGAGAACAATCTGTCTAAACTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022801.1-887s1c1
Sequence:CCGGCGGGAAGTACAGAATCCCTTTCTCGAGAAAGGGATTCTGTACTTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022801.1-245s1c1
Sequence:CCGGCGGAAACTACAGACTGTTGAACTCGAGTTCAACAGTCTGTAGTTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022801.1-1251s1c1
Sequence:CCGGCCAAACAGTGACCTCAGCAATCTCGAGATTGCTGAGGTCACTGTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022801.1-1672s1c1
Sequence:CCGGGCGCTATTCCAGATGAGAGAACTCGAGTTCTCTCATCTGGAATAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022801.4-1543s21c1
Sequence:CCGGTATGGTGGGAATGGGATATTCCTCGAGGAATATCCCATTCCCACCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022801.4-2253s21c1
Sequence:CCGGAGCGGCGAACCGCAACATATACTCGAGTATATGTTGCGGTTCGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022801.4-2731s21c1
Sequence:CCGGACCCAGTAATTATGGTGTAAACTCGAGTTTACACCATAATTACTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022801.4-3149s21c1
Sequence:CCGGACCTTAAGGCTAGTTGATAATCTCGAGATTATCAACTAGCCTTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022801.4-2800s21c1
Sequence:CCGGGAGTAATATTTAGGCAATAACCTCGAGGTTATTGCCTAAATATTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022801.4-2642s21c1
Sequence:CCGGCTGAATGGAGTCCGGTTTAAGCTCGAGCTTAAACCGGACTCCATTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022801.4-773s21c1
Sequence:CCGGACAGGCCGAGAGGTTGCAATACTCGAGTATTGCAACCTCTCGGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022801.4-1090s21c1
Sequence:CCGGTCTGTTATTAGATGCGGATATCTCGAGATATCCGCATCTAATAACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022801
VALIDATED
MARK3 MISSION shRNA Lentiviral Transduction Particles
MAP/microtubule affinity-regulating kinase 3
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022801.1-555s1c1
Sequence:CCGGGCTAAGTTTAGACAGATTGTTCTCGAGAACAATCTGTCTAAACTTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022801.1-887s1c1
Sequence:CCGGCGGGAAGTACAGAATCCCTTTCTCGAGAAAGGGATTCTGTACTTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022801.1-245s1c1
Sequence:CCGGCGGAAACTACAGACTGTTGAACTCGAGTTCAACAGTCTGTAGTTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022801.1-1251s1c1
Sequence:CCGGCCAAACAGTGACCTCAGCAATCTCGAGATTGCTGAGGTCACTGTTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022801.1-1672s1c1
Sequence:CCGGGCGCTATTCCAGATGAGAGAACTCGAGTTCTCTCATCTGGAATAGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022801.4-1543s21c1
Sequence:CCGGTATGGTGGGAATGGGATATTCCTCGAGGAATATCCCATTCCCACCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022801.4-2253s21c1
Sequence:CCGGAGCGGCGAACCGCAACATATACTCGAGTATATGTTGCGGTTCGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022801.4-2731s21c1
Sequence:CCGGACCCAGTAATTATGGTGTAAACTCGAGTTTACACCATAATTACTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022801.4-3149s21c1
Sequence:CCGGACCTTAAGGCTAGTTGATAATCTCGAGATTATCAACTAGCCTTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022801.4-2800s21c1
Sequence:CCGGGAGTAATATTTAGGCAATAACCTCGAGGTTATTGCCTAAATATTACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022801.4-2642s21c1
Sequence:CCGGCTGAATGGAGTCCGGTTTAAGCTCGAGCTTAAACCGGACTCCATTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022801.4-773s21c1
Sequence:CCGGACAGGCCGAGAGGTTGCAATACTCGAGTATTGCAACCTCTCGGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022801.4-1090s21c1
Sequence:CCGGTCTGTTATTAGATGCGGATATCTCGAGATATCCGCATCTAATAACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)