EMAIL THIS PAGE TO A FRIEND

MARK4

MAP/microtubule affinity-regulating kinase 4

126 Gene Product Result for
Synonyms: MARK4L MARK4S MARKL1 MARKL1L PAR-1D
UniProtKB ID: Q96L34, Q8NG37, Q96JG7, Q96SQ2, Q9BYD8
Gene ID:
Human(57787) Summary: This gene encodes a member of the microtubule affinity-regulating kinase family. These protein kinases phosphorylate microtubule-associated proteins and regulate the transition between stable and dynamic microtubules. The encoded protein is associated with the centrosome throughout mitosis and may be involved in cell cycle control. Expression of this gene is a potential marker for cancer, and the encoded protein may also play a role in Alzheimer's disease. Pseudogenes of this gene are located on both the short and long arm of chromosome 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Mouse(232944) MAP/microtubule affinity-regulating kinase 4
Rat(680407) MAP/microtubule affinity-regulating kinase 4
naked mole-rat(101726420) MAP/microtubule affinity-regulating kinase 4
domestic guinea pig(100733296) MAP/microtubule affinity-regulating kinase 4
sheep(101115819) MAP/microtubule affinity-regulating kinase 4
cow(525675) MAP/microtubule affinity-regulating kinase 4
Horse(100070770) MAP/microtubule affinity-regulating kinase 4
domestic cat(101084500) MAP/microtubule affinity-regulating kinase 4
dog(484449) MAP/microtubule affinity-regulating kinase 4
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172279 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172279 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172279 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031417 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031417 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031417 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU031591 MISSION® esiRNA esiRNA targeting mouse Mark4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031417 Rosetta Predictions human pricing
XM_001057742 Rosetta Predictions rat pricing
NM_172279 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087848 predicted 2442
2 SASI_Hs01_00087849 predicted 624
3 SASI_Hs01_00087851 predicted 254
4 SASI_Hs01_00087852 predicted 358
5 SASI_Hs01_00087853 predicted 2423
6 SASI_Hs01_00087854 predicted 813
7 SASI_Hs01_00087855 predicted 325
8 SASI_Hs01_00087856 predicted 483
9 SASI_Hs01_00087857 predicted 884
10 SASI_Hs02_00358801 predicted 1506
11 SASI_Hs01_00087850 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057742 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287409 predicted 722
2 SASI_Rn02_00287410 predicted 306
3 SASI_Rn02_00287411 predicted 386
4 SASI_Rn02_00287412 predicted 1508
5 SASI_Rn02_00287413 predicted 1514
6 SASI_Rn02_00287414 predicted 1922
7 SASI_Rn02_00287415 predicted 396
8 SASI_Rn02_00287416 predicted 383
9 SASI_Rn02_00287417 predicted 900
10 SASI_Rn02_00287418 predicted 249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172279 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055593 predicted 306
2 SASI_Mm01_00055594 predicted 1502
3 SASI_Mm01_00055595 predicted 383
4 SASI_Mm01_00055596 predicted 1517
5 SASI_Mm01_00055597 predicted 1569
6 SASI_Mm01_00055599 predicted 253
7 SASI_Mm02_00343757 predicted 514
8 SASI_Mm01_00055600 predicted 318
9 SASI_Mm01_00055601 predicted 1919
10 SASI_Mm01_00055602 predicted 921
11 SASI_Mm01_00055598 predicted 1555
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172279
VALIDATED
MARK4 MISSION shRNA Bacterial Glycerol Stock
MAP/microtubule affinity-regulating kinase 4
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172279.1-413s21c1
Sequence:CCGGCTAGCGCAGGAGAAGTGTTTGCTCGAGCAAACACTTCTCCTGCGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172279.1-309s21c1
Sequence:CCGGGTTCAGAGAAGTCCGAATTATCTCGAGATAATTCGGACTTCTCTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172279.1-850s21c1
Sequence:CCGGGAGAGCATTCTGCGGAGATTTCTCGAGAAATCTCCGCAGAATGCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172279.1-68s21c1
Sequence:CCGGGTGGACGATCTTCGGACAAAGCTCGAGCTTTGTCCGAAGATCGTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172279.1-216s21c1
Sequence:CCGGAGTCAAGCTGGCTCGGCATATCTCGAGATATGCCGAGCCAGCTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172279.1-892s21c1
Sequence:CCGGCGCTGTACTCTGGAGCAAATCCTCGAGGATTTGCTCCAGAGTACAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172279.1-253s1c1
Sequence:CCGGGTCGCTATTAAGATCATTGATCTCGAGATCAATGATCTTAATAGCGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172279.1-1520s1c1
Sequence:CCGGCCCGAAGAAACACCTATGTGTCTCGAGACACATAGGTGTTTCTTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172279.1-384s1c1
Sequence:CCGGGAAGACGCTATACCTGGTGATCTCGAGATCACCAGGTATAGCGTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172279.1-993s1c1
Sequence:CCGGCACCAAGAGAATTGAGGTGATCTCGAGATCACCTCAATTCTCTTGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172279.1-504s1c1
Sequence:CCGGCGTGCACTACTGTCATCAGAACTCGAGTTCTGATGACAGTAGTGCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172279
VALIDATED
MARK4 MISSION shRNA shRNA Plasmid DNA
MAP/microtubule affinity-regulating kinase 4
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172279.1-413s21c1
Sequence:CCGGCTAGCGCAGGAGAAGTGTTTGCTCGAGCAAACACTTCTCCTGCGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172279.1-309s21c1
Sequence:CCGGGTTCAGAGAAGTCCGAATTATCTCGAGATAATTCGGACTTCTCTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172279.1-850s21c1
Sequence:CCGGGAGAGCATTCTGCGGAGATTTCTCGAGAAATCTCCGCAGAATGCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172279.1-68s21c1
Sequence:CCGGGTGGACGATCTTCGGACAAAGCTCGAGCTTTGTCCGAAGATCGTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172279.1-216s21c1
Sequence:CCGGAGTCAAGCTGGCTCGGCATATCTCGAGATATGCCGAGCCAGCTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172279.1-892s21c1
Sequence:CCGGCGCTGTACTCTGGAGCAAATCCTCGAGGATTTGCTCCAGAGTACAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172279.1-253s1c1
Sequence:CCGGGTCGCTATTAAGATCATTGATCTCGAGATCAATGATCTTAATAGCGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172279.1-1520s1c1
Sequence:CCGGCCCGAAGAAACACCTATGTGTCTCGAGACACATAGGTGTTTCTTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172279.1-384s1c1
Sequence:CCGGGAAGACGCTATACCTGGTGATCTCGAGATCACCAGGTATAGCGTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172279.1-993s1c1
Sequence:CCGGCACCAAGAGAATTGAGGTGATCTCGAGATCACCTCAATTCTCTTGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172279.1-504s1c1
Sequence:CCGGCGTGCACTACTGTCATCAGAACTCGAGTTCTGATGACAGTAGTGCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172279
VALIDATED
MARK4 MISSION shRNA Lentiviral Transduction Particles
MAP/microtubule affinity-regulating kinase 4
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172279.1-413s21c1
Sequence:CCGGCTAGCGCAGGAGAAGTGTTTGCTCGAGCAAACACTTCTCCTGCGCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172279.1-309s21c1
Sequence:CCGGGTTCAGAGAAGTCCGAATTATCTCGAGATAATTCGGACTTCTCTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172279.1-850s21c1
Sequence:CCGGGAGAGCATTCTGCGGAGATTTCTCGAGAAATCTCCGCAGAATGCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172279.1-68s21c1
Sequence:CCGGGTGGACGATCTTCGGACAAAGCTCGAGCTTTGTCCGAAGATCGTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172279.1-216s21c1
Sequence:CCGGAGTCAAGCTGGCTCGGCATATCTCGAGATATGCCGAGCCAGCTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172279.1-892s21c1
Sequence:CCGGCGCTGTACTCTGGAGCAAATCCTCGAGGATTTGCTCCAGAGTACAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172279.1-253s1c1
Sequence:CCGGGTCGCTATTAAGATCATTGATCTCGAGATCAATGATCTTAATAGCGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172279.1-1520s1c1
Sequence:CCGGCCCGAAGAAACACCTATGTGTCTCGAGACACATAGGTGTTTCTTCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172279.1-384s1c1
Sequence:CCGGGAAGACGCTATACCTGGTGATCTCGAGATCACCAGGTATAGCGTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172279.1-993s1c1
Sequence:CCGGCACCAAGAGAATTGAGGTGATCTCGAGATCACCTCAATTCTCTTGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172279.1-504s1c1
Sequence:CCGGCGTGCACTACTGTCATCAGAACTCGAGTTCTGATGACAGTAGTGCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031417
VALIDATED
MARK4 MISSION shRNA Bacterial Glycerol Stock
MAP/microtubule affinity-regulating kinase 4
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031417.2-3631s1c1
Sequence:CCGGGCAAGAGAAATGCTGTATTAGCTCGAGCTAATACAGCATTTCTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031417.2-920s1c1
Sequence:CCGGGAAAGACAAATGGATCAACATCTCGAGATGTTGATCCATTTGTCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031417.2-2961s1c1
Sequence:CCGGGCAGCCTGTTGCCCAATAAATCTCGAGATTTATTGGGCAACAGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031417.2-1997s1c1
Sequence:CCGGGAGGTCACAAGTTGCCATCTACTCGAGTAGATGGCAACTTGTGACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031417.2-1178s1c1
Sequence:CCGGCGACACCACCAACGGAACAAGCTCGAGCTTGTTCCGTTGGTGGTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031417.2-855s1c1
Sequence:CCGGGAGAGCATCCTGCGGAGATTTCTCGAGAAATCTCCGCAGGATGCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031417.2-2010s21c1
Sequence:CCGGGCCATCTACCTTGGGATCAAACTCGAGTTTGATCCCAAGGTAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031417.2-480s21c1
Sequence:CCGGCGAGCCAAGTTCCGACAGATTCTCGAGAATCTGTCGGAACTTGGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031417.2-2431s21c1
Sequence:CCGGCCCTTTATCATCACCTCAGTTCTCGAGAACTGAGGTGATGATAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007156    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031417.2-2431s1c1
Sequence:CCGGCCCTTTATCATCACCTCAGTTCTCGAGAACTGAGGTGATGATAAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031417.2-351s1c1
Sequence:CCGGCCCAACATCGTGAAGCTCTTTCTCGAGAAAGAGCTTCACGATGTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031417.2-261s21c1
Sequence:CCGGGCCATCAAGATTATCGACAAACTCGAGTTTGTCGATAATCTTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031417.2-1908s1c1
Sequence:CCGGCAGAACTCTAACCGCTGTGTTCTCGAGAACACAGCGGTTAGAGTTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031417.2-2010s1c1
Sequence:CCGGGCCATCTACCTTGGGATCAAACTCGAGTTTGATCCCAAGGTAGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031417.2-261s1c1
Sequence:CCGGGCCATCAAGATTATCGACAAACTCGAGTTTGTCGATAATCTTGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031417.2-480s1c1
Sequence:CCGGCGAGCCAAGTTCCGACAGATTCTCGAGAATCTGTCGGAACTTGGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031417
VALIDATED
MARK4 MISSION shRNA shRNA Plasmid DNA
MAP/microtubule affinity-regulating kinase 4
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031417.2-3631s1c1
Sequence:CCGGGCAAGAGAAATGCTGTATTAGCTCGAGCTAATACAGCATTTCTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031417.2-920s1c1
Sequence:CCGGGAAAGACAAATGGATCAACATCTCGAGATGTTGATCCATTTGTCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031417.2-2961s1c1
Sequence:CCGGGCAGCCTGTTGCCCAATAAATCTCGAGATTTATTGGGCAACAGGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031417.2-1997s1c1
Sequence:CCGGGAGGTCACAAGTTGCCATCTACTCGAGTAGATGGCAACTTGTGACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031417.2-1178s1c1
Sequence:CCGGCGACACCACCAACGGAACAAGCTCGAGCTTGTTCCGTTGGTGGTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031417.2-855s1c1
Sequence:CCGGGAGAGCATCCTGCGGAGATTTCTCGAGAAATCTCCGCAGGATGCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031417.2-2010s21c1
Sequence:CCGGGCCATCTACCTTGGGATCAAACTCGAGTTTGATCCCAAGGTAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031417.2-480s21c1
Sequence:CCGGCGAGCCAAGTTCCGACAGATTCTCGAGAATCTGTCGGAACTTGGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031417.2-2431s21c1
Sequence:CCGGCCCTTTATCATCACCTCAGTTCTCGAGAACTGAGGTGATGATAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007156    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031417.2-2431s1c1
Sequence:CCGGCCCTTTATCATCACCTCAGTTCTCGAGAACTGAGGTGATGATAAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031417.2-351s1c1
Sequence:CCGGCCCAACATCGTGAAGCTCTTTCTCGAGAAAGAGCTTCACGATGTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031417.2-261s21c1
Sequence:CCGGGCCATCAAGATTATCGACAAACTCGAGTTTGTCGATAATCTTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031417.2-1908s1c1
Sequence:CCGGCAGAACTCTAACCGCTGTGTTCTCGAGAACACAGCGGTTAGAGTTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031417.2-2010s1c1
Sequence:CCGGGCCATCTACCTTGGGATCAAACTCGAGTTTGATCCCAAGGTAGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031417.2-261s1c1
Sequence:CCGGGCCATCAAGATTATCGACAAACTCGAGTTTGTCGATAATCTTGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031417.2-480s1c1
Sequence:CCGGCGAGCCAAGTTCCGACAGATTCTCGAGAATCTGTCGGAACTTGGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031417
VALIDATED
MARK4 MISSION shRNA Lentiviral Transduction Particles
MAP/microtubule affinity-regulating kinase 4
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031417.2-3631s1c1
Sequence:CCGGGCAAGAGAAATGCTGTATTAGCTCGAGCTAATACAGCATTTCTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031417.2-920s1c1
Sequence:CCGGGAAAGACAAATGGATCAACATCTCGAGATGTTGATCCATTTGTCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031417.2-2961s1c1
Sequence:CCGGGCAGCCTGTTGCCCAATAAATCTCGAGATTTATTGGGCAACAGGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031417.2-1997s1c1
Sequence:CCGGGAGGTCACAAGTTGCCATCTACTCGAGTAGATGGCAACTTGTGACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031417.2-1178s1c1
Sequence:CCGGCGACACCACCAACGGAACAAGCTCGAGCTTGTTCCGTTGGTGGTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031417.2-855s1c1
Sequence:CCGGGAGAGCATCCTGCGGAGATTTCTCGAGAAATCTCCGCAGGATGCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031417.2-2010s21c1
Sequence:CCGGGCCATCTACCTTGGGATCAAACTCGAGTTTGATCCCAAGGTAGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031417.2-480s21c1
Sequence:CCGGCGAGCCAAGTTCCGACAGATTCTCGAGAATCTGTCGGAACTTGGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031417.2-2431s21c1
Sequence:CCGGCCCTTTATCATCACCTCAGTTCTCGAGAACTGAGGTGATGATAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007156    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031417.2-2431s1c1
Sequence:CCGGCCCTTTATCATCACCTCAGTTCTCGAGAACTGAGGTGATGATAAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031417.2-351s1c1
Sequence:CCGGCCCAACATCGTGAAGCTCTTTCTCGAGAAAGAGCTTCACGATGTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031417.2-261s21c1
Sequence:CCGGGCCATCAAGATTATCGACAAACTCGAGTTTGTCGATAATCTTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031417.2-1908s1c1
Sequence:CCGGCAGAACTCTAACCGCTGTGTTCTCGAGAACACAGCGGTTAGAGTTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031417.2-2010s1c1
Sequence:CCGGGCCATCTACCTTGGGATCAAACTCGAGTTTGATCCCAAGGTAGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031417.2-261s1c1
Sequence:CCGGGCCATCAAGATTATCGACAAACTCGAGTTTGTCGATAATCTTGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_031417.2-480s1c1
Sequence:CCGGCGAGCCAAGTTCCGACAGATTCTCGAGAATCTGTCGGAACTTGGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)