EMAIL THIS PAGE TO A FRIEND

MARS

methionyl-tRNA synthetase

58 Gene Product Result for
Synonyms: METRS MRS MTRNS
UniProtKB ID: P56192, Q14895, Q53H14, Q96A15, Q96BZ0, Q9NSE0
Gene ID:
Human(4141) Summary: This gene encodes a member of the class I family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. The encoded protein is a component of the multi-tRNA synthetase complex and catalyzes the ligation of methionine to tRNA molecules. [provided by RefSeq, Jan 2011]
Mouse(216443) methionine-tRNA synthetase
Rat(299851) methionyl-tRNA synthetase
sheep(101121335) methionyl-tRNA synthetase
domestic guinea pig(100721918) methionyl-tRNA synthetase
naked mole-rat(101715045) methionyl-tRNA synthetase
Domestic Rabbit(100338022) methionyl-tRNA synthetase
Zebrafish(338183) methionine-tRNA synthetase
chicken(425613) methionyl-tRNA synthetase
fruit fly(36498) CG17064 gene product from transcript CG17064-RB
cow(512531) methionyl-tRNA synthetase
Horse(100053373) methionyl-tRNA synthetase
domestic cat(101093699) methionyl-tRNA synthetase
dog(474414) methionyl-tRNA synthetase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004990 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004990 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004990 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001003913 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001003913 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001003913 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004990 Rosetta Predictions human pricing
NM_001127659 Rosetta Predictions rat pricing
XM_216910 Rosetta Predictions rat pricing
NM_001003913 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004990 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032599 predicted 1322
2 SASI_Hs01_00032600 predicted 468
3 SASI_Hs01_00032601 predicted 1775
4 SASI_Hs01_00032602 predicted 1300
5 SASI_Hs01_00032603 predicted 2358
6 SASI_Hs01_00032604 predicted 940
7 SASI_Hs01_00032605 predicted 2168
8 SASI_Hs01_00032606 predicted 545
9 SASI_Hs01_00032607 predicted 1453
10 SASI_Hs01_00032608 predicted 1868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127659 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254820 predicted 1036
2 SASI_Rn02_00254821 predicted 1741
3 SASI_Rn02_00254822 predicted 1011
4 SASI_Rn02_00254823 predicted 2494
5 SASI_Rn02_00254824 predicted 1300
6 SASI_Rn02_00254825 predicted 1044
7 SASI_Rn02_00254826 predicted 1571
8 SASI_Rn02_00254827 predicted 1026
9 SASI_Rn02_00254828 predicted 1640
10 SASI_Rn02_00254829 predicted 1564
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216910 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00183958 predicted 1086
2 SASI_Rn01_00183959 predicted 1791
3 SASI_Rn01_00183960 predicted 1068
4 SASI_Rn01_00183961 predicted 1349
5 SASI_Rn01_00183962 predicted 1104
6 SASI_Rn01_00183963 predicted 1628
7 SASI_Rn01_00183964 predicted 1700
8 SASI_Rn01_00183965 predicted 1694
9 SASI_Rn01_00183966 predicted 1617
10 SASI_Rn01_00183967 predicted 939
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003913 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100528 predicted 1638
2 SASI_Mm01_00100529 predicted 2268
3 SASI_Mm01_00100530 predicted 2157
4 SASI_Mm01_00100531 predicted 1302
5 SASI_Mm01_00100532 predicted 1775
6 SASI_Mm01_00100533 predicted 1140
7 SASI_Mm02_00286355 predicted 2242
8 SASI_Mm01_00100534 predicted 1576
9 SASI_Mm01_00100535 predicted 1050
10 SASI_Mm01_00100536 predicted 1562
11 SASI_Mm01_00100537 predicted 1862
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004990
VALIDATED
MARS MISSION shRNA Bacterial Glycerol Stock
methionyl-tRNA synthetase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004990.2-1875s21c1
Sequence:CCGGCGCTTCTATCTGCTGTACATTCTCGAGAATGTACAGCAGATAGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_004990.2-1456s1c1
Sequence:CCGGCCCAGTTTATCACCCGTTCTTCTCGAGAAGAACGGGTGATAAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004990.2-1875s1c1
Sequence:CCGGCGCTTCTATCTGCTGTACATTCTCGAGAATGTACAGCAGATAGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004990.2-321s1c1
Sequence:CCGGCTGTACTATTTAGTGGTCCAACTCGAGTTGGACCACTAAATAGTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004990.2-1055s1c1
Sequence:CCGGCCGCTGGTTTAACATTTCGTTCTCGAGAACGAAATGTTAAACCAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004990.2-2577s1c1
Sequence:CCGGCAAGGAAACATTGTCCGAGAACTCGAGTTCTCGGACAATGTTTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004990.2-208s21c1
Sequence:CCGGCTAGTGCAATCTGCCGATATTCTCGAGAATATCGGCAGATTGCACTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004990.2-1055s21c1
Sequence:CCGGCCGCTGGTTTAACATTTCGTTCTCGAGAACGAAATGTTAAACCAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004990.2-2577s21c1
Sequence:CCGGCAAGGAAACATTGTCCGAGAACTCGAGTTCTCGGACAATGTTTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004990.2-2159s21c1
Sequence:CCGGTCGACATGGCAACCAATATATCTCGAGATATATTGGTTGCCATGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004990
VALIDATED
MARS MISSION shRNA shRNA Plasmid DNA
methionyl-tRNA synthetase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004990.2-1875s21c1
Sequence:CCGGCGCTTCTATCTGCTGTACATTCTCGAGAATGTACAGCAGATAGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_004990.2-1456s1c1
Sequence:CCGGCCCAGTTTATCACCCGTTCTTCTCGAGAAGAACGGGTGATAAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004990.2-1875s1c1
Sequence:CCGGCGCTTCTATCTGCTGTACATTCTCGAGAATGTACAGCAGATAGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004990.2-321s1c1
Sequence:CCGGCTGTACTATTTAGTGGTCCAACTCGAGTTGGACCACTAAATAGTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004990.2-1055s1c1
Sequence:CCGGCCGCTGGTTTAACATTTCGTTCTCGAGAACGAAATGTTAAACCAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004990.2-2577s1c1
Sequence:CCGGCAAGGAAACATTGTCCGAGAACTCGAGTTCTCGGACAATGTTTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004990.2-208s21c1
Sequence:CCGGCTAGTGCAATCTGCCGATATTCTCGAGAATATCGGCAGATTGCACTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004990.2-1055s21c1
Sequence:CCGGCCGCTGGTTTAACATTTCGTTCTCGAGAACGAAATGTTAAACCAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004990.2-2577s21c1
Sequence:CCGGCAAGGAAACATTGTCCGAGAACTCGAGTTCTCGGACAATGTTTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004990.2-2159s21c1
Sequence:CCGGTCGACATGGCAACCAATATATCTCGAGATATATTGGTTGCCATGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004990
VALIDATED
MARS MISSION shRNA Lentiviral Transduction Particles
methionyl-tRNA synthetase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004990.2-1875s21c1
Sequence:CCGGCGCTTCTATCTGCTGTACATTCTCGAGAATGTACAGCAGATAGAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_004990.2-1456s1c1
Sequence:CCGGCCCAGTTTATCACCCGTTCTTCTCGAGAAGAACGGGTGATAAACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004990.2-1875s1c1
Sequence:CCGGCGCTTCTATCTGCTGTACATTCTCGAGAATGTACAGCAGATAGAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004990.2-321s1c1
Sequence:CCGGCTGTACTATTTAGTGGTCCAACTCGAGTTGGACCACTAAATAGTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004990.2-1055s1c1
Sequence:CCGGCCGCTGGTTTAACATTTCGTTCTCGAGAACGAAATGTTAAACCAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004990.2-2577s1c1
Sequence:CCGGCAAGGAAACATTGTCCGAGAACTCGAGTTCTCGGACAATGTTTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004990.2-208s21c1
Sequence:CCGGCTAGTGCAATCTGCCGATATTCTCGAGAATATCGGCAGATTGCACTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004990.2-1055s21c1
Sequence:CCGGCCGCTGGTTTAACATTTCGTTCTCGAGAACGAAATGTTAAACCAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004990.2-2577s21c1
Sequence:CCGGCAAGGAAACATTGTCCGAGAACTCGAGTTCTCGGACAATGTTTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004990.2-2159s21c1
Sequence:CCGGTCGACATGGCAACCAATATATCTCGAGATATATTGGTTGCCATGTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003913
VALIDATED
MARS MISSION shRNA Bacterial Glycerol Stock
methionyl-tRNA synthetase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003913.1-2633s1c1
Sequence:CCGGGTGGCTAAACTCTTGGATCTACTCGAGTAGATCCAAGAGTTTAGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003913.1-1057s1c1
Sequence:CCGGCGGCATATCGTTCGATACTTTCTCGAGAAAGTATCGAACGATATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003913.1-194s1c1
Sequence:CCGGGCTAGTGCAATCTGCCGATATCTCGAGATATCGGCAGATTGCACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003913.1-1564s1c1
Sequence:CCGGCGTCTGGTTTGATGCTACTATCTCGAGATAGTAGCATCAAACCAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003913.1-1753s1c1
Sequence:CCGGGCACATCATTGCTACAGAGTACTCGAGTACTCTGTAGCAATGATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003913
VALIDATED
MARS MISSION shRNA shRNA Plasmid DNA
methionyl-tRNA synthetase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003913.1-2633s1c1
Sequence:CCGGGTGGCTAAACTCTTGGATCTACTCGAGTAGATCCAAGAGTTTAGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003913.1-1057s1c1
Sequence:CCGGCGGCATATCGTTCGATACTTTCTCGAGAAAGTATCGAACGATATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003913.1-194s1c1
Sequence:CCGGGCTAGTGCAATCTGCCGATATCTCGAGATATCGGCAGATTGCACTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003913.1-1564s1c1
Sequence:CCGGCGTCTGGTTTGATGCTACTATCTCGAGATAGTAGCATCAAACCAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003913.1-1753s1c1
Sequence:CCGGGCACATCATTGCTACAGAGTACTCGAGTACTCTGTAGCAATGATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003913
VALIDATED
MARS MISSION shRNA Lentiviral Transduction Particles
methionyl-tRNA synthetase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003913.1-2633s1c1
Sequence:CCGGGTGGCTAAACTCTTGGATCTACTCGAGTAGATCCAAGAGTTTAGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003913.1-1057s1c1
Sequence:CCGGCGGCATATCGTTCGATACTTTCTCGAGAAAGTATCGAACGATATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003913.1-194s1c1
Sequence:CCGGGCTAGTGCAATCTGCCGATATCTCGAGATATCGGCAGATTGCACTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003913.1-1564s1c1
Sequence:CCGGCGTCTGGTTTGATGCTACTATCTCGAGATAGTAGCATCAAACCAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001003913.1-1753s1c1
Sequence:CCGGGCACATCATTGCTACAGAGTACTCGAGTACTCTGTAGCAATGATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)