EMAIL THIS PAGE TO A FRIEND

MARVELD1

MARVEL domain containing 1

90 Gene Product Result for
Synonyms: GB14 MARVD1 MRVLDC1 RP11-548K23.8 bA548K23.8
UniProtKB ID: Q9BSK0
Gene ID:
Mouse(277010) MARVEL (membrane-associating) domain containing 1
Rat(309375) MARVEL domain containing 1
sheep(101109317) MARVEL domain containing 1
domestic guinea pig(100721855) MARVEL domain containing 1
naked mole-rat(101702815) MARVEL domain containing 1
Zebrafish(497317) MARVEL domain containing 1
cow(616867) MARVEL domain containing 1
chicken(100858221) MARVEL domain containing 1
dog(608798) MARVEL domain containing 1
domestic cat(101088436) MARVEL domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183195 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183195 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183195 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031484 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031484 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031484 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU196401 MISSION® esiRNA esiRNA targeting mouse Marveld1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031484 Rosetta Predictions human pricing
XR_041875 Rosetta Predictions human pricing
XR_041876 Rosetta Predictions human pricing
XR_041877 Rosetta Predictions human pricing
NM_001107590 Rosetta Predictions rat pricing
NM_183195 Rosetta Predictions mouse pricing
XR_035382 Rosetta Predictions mouse pricing
XR_035422 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031484 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138554 predicted 3159
2 SASI_Hs01_00138555 predicted 2557
3 SASI_Hs01_00138556 predicted 2113
4 SASI_Hs01_00138557 predicted 2875
5 SASI_Hs01_00138558 predicted 3067
6 SASI_Hs01_00138559 predicted 2556
7 SASI_Hs01_00138560 predicted 2866
8 SASI_Hs01_00138561 predicted 2578
9 SASI_Hs01_00138562 predicted 3152
10 SASI_Hs01_00138563 predicted 1355
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041875 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00531122 predicted 1828
2 SASI_Hs02_00531123 predicted 2124
3 SASI_Hs02_00531124 predicted 1819
4 SASI_Hs02_00531125 predicted 2122
5 SASI_Hs02_00531126 predicted 1813
6 SASI_Hs02_00531127 predicted 1367
7 SASI_Hs02_00531128 predicted 1830
8 SASI_Hs02_00531129 predicted 1747
9 SASI_Hs02_00531130 predicted 1892
10 SASI_Hs02_00531131 predicted 1798
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041876 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00531132 predicted 1823
2 SASI_Hs02_00531133 predicted 2122
3 SASI_Hs02_00531134 predicted 1819
4 SASI_Hs02_00531135 predicted 2123
5 SASI_Hs02_00531136 predicted 1816
6 SASI_Hs02_00531137 predicted 1364
7 SASI_Hs02_00531138 predicted 1827
8 SASI_Hs02_00531139 predicted 1747
9 SASI_Hs02_00531140 predicted 1889
10 SASI_Hs02_00531141 predicted 1794
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00531142 predicted 1828
2 SASI_Hs02_00531143 predicted 2118
3 SASI_Hs02_00531144 predicted 1817
4 SASI_Hs02_00531145 predicted 2120
5 SASI_Hs02_00531146 predicted 1817
6 SASI_Hs02_00531147 predicted 1360
7 SASI_Hs02_00531148 predicted 1824
8 SASI_Hs02_00531149 predicted 1743
9 SASI_Hs02_00531150 predicted 1884
10 SASI_Hs02_00531151 predicted 1791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107590 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230335 predicted 2213
2 SASI_Rn02_00230336 predicted 2413
3 SASI_Rn02_00230337 predicted 2408
4 SASI_Rn02_00230338 predicted 2284
5 SASI_Rn02_00230339 predicted 2412
6 SASI_Rn02_00230340 predicted 2223
7 SASI_Rn02_00230341 predicted 2226
8 SASI_Rn02_00230342 predicted 2539
9 SASI_Rn02_00230343 predicted 2242
10 SASI_Rn02_00230344 predicted 2329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183195 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105453 predicted 761
2 SASI_Mm01_00105454 predicted 1222
3 SASI_Mm01_00105455 predicted 585
4 SASI_Mm01_00105456 predicted 1239
5 SASI_Mm01_00105457 predicted 1246
6 SASI_Mm01_00105458 predicted 913
7 SASI_Mm01_00105459 predicted 1084
8 SASI_Mm01_00105460 predicted 885
9 SASI_Mm01_00105461 predicted 1232
10 SASI_Mm01_00105462 predicted 787
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_035382 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00482188 predicted 2070
2 SASI_Mm02_00482189 predicted 1385
3 SASI_Mm02_00482190 predicted 2111
4 SASI_Mm02_00482191 predicted 1245
5 SASI_Mm02_00482192 predicted 1021
6 SASI_Mm02_00482193 predicted 1997
7 SASI_Mm02_00482194 predicted 872
8 SASI_Mm02_00482195 predicted 1182
9 SASI_Mm02_00482196 predicted 2019
10 SASI_Mm02_00482197 predicted 2329
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_035422 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00482586 predicted 2312
2 SASI_Mm02_00482587 predicted 1626
3 SASI_Mm02_00482588 predicted 2362
4 SASI_Mm02_00482589 predicted 1487
5 SASI_Mm02_00482590 predicted 1268
6 SASI_Mm02_00482591 predicted 2236
7 SASI_Mm02_00482592 predicted 1120
8 SASI_Mm02_00482593 predicted 1423
9 SASI_Mm02_00482594 predicted 2261
10 SASI_Mm02_00482595 predicted 2571
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183195
MARVELD1 MISSION shRNA Bacterial Glycerol Stock
MARVEL domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183195.1-349s1c1
Sequence:CCGGAGCCGCCTTCTGGATCACCATCTCGAGATGGTGATCCAGAAGGCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183195.1-682s1c1
Sequence:CCGGCTACCTACTCTCGGCACTCTACTCGAGTAGAGTGCCGAGAGTAGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183195.1-445s1c1
Sequence:CCGGGCTCTACTTCATCACGCTGTTCTCGAGAACAGCGTGATGAAGTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183195.1-595s1c1
Sequence:CCGGCTACTGCAACCTCAAGAACTACTCGAGTAGTTCTTGAGGTTGCAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183195.1-1698s1c1
Sequence:CCGGCCGAGCACATTCACAATGTTTCTCGAGAAACATTGTGAATGTGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183195.2-1036s21c1
Sequence:CCGGTGGAAGTCCCTTTCCTCATTCCTCGAGGAATGAGGAAAGGGACTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183195.2-915s21c1
Sequence:CCGGGACGTTCAGTTCTAGTCTGACCTCGAGGTCAGACTAGAACTGAACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183195.2-404s21c1
Sequence:CCGGCATTGCCACCAGCAAGTACCACTCGAGTGGTACTTGCTGGTGGCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434830    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183195.2-1200s21c1
Sequence:CCGGAGCCTAGGGAGGTGTAGAATGCTCGAGCATTCTACACCTCCCTAGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183195.2-603s21c1
Sequence:CCGGATCATGATCGACCAGACGCAGCTCGAGCTGCGTCTGGTCGATCATGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183195
MARVELD1 MISSION shRNA shRNA Plasmid DNA
MARVEL domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183195.1-349s1c1
Sequence:CCGGAGCCGCCTTCTGGATCACCATCTCGAGATGGTGATCCAGAAGGCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183195.1-682s1c1
Sequence:CCGGCTACCTACTCTCGGCACTCTACTCGAGTAGAGTGCCGAGAGTAGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183195.1-445s1c1
Sequence:CCGGGCTCTACTTCATCACGCTGTTCTCGAGAACAGCGTGATGAAGTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183195.1-595s1c1
Sequence:CCGGCTACTGCAACCTCAAGAACTACTCGAGTAGTTCTTGAGGTTGCAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183195.1-1698s1c1
Sequence:CCGGCCGAGCACATTCACAATGTTTCTCGAGAAACATTGTGAATGTGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183195.2-1036s21c1
Sequence:CCGGTGGAAGTCCCTTTCCTCATTCCTCGAGGAATGAGGAAAGGGACTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183195.2-915s21c1
Sequence:CCGGGACGTTCAGTTCTAGTCTGACCTCGAGGTCAGACTAGAACTGAACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183195.2-404s21c1
Sequence:CCGGCATTGCCACCAGCAAGTACCACTCGAGTGGTACTTGCTGGTGGCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434830    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183195.2-1200s21c1
Sequence:CCGGAGCCTAGGGAGGTGTAGAATGCTCGAGCATTCTACACCTCCCTAGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183195.2-603s21c1
Sequence:CCGGATCATGATCGACCAGACGCAGCTCGAGCTGCGTCTGGTCGATCATGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183195
MARVELD1 MISSION shRNA Lentiviral Transduction Particles
MARVEL domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183195.1-349s1c1
Sequence:CCGGAGCCGCCTTCTGGATCACCATCTCGAGATGGTGATCCAGAAGGCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183195.1-682s1c1
Sequence:CCGGCTACCTACTCTCGGCACTCTACTCGAGTAGAGTGCCGAGAGTAGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183195.1-445s1c1
Sequence:CCGGGCTCTACTTCATCACGCTGTTCTCGAGAACAGCGTGATGAAGTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183195.1-595s1c1
Sequence:CCGGCTACTGCAACCTCAAGAACTACTCGAGTAGTTCTTGAGGTTGCAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183195.1-1698s1c1
Sequence:CCGGCCGAGCACATTCACAATGTTTCTCGAGAAACATTGTGAATGTGCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183195.2-1036s21c1
Sequence:CCGGTGGAAGTCCCTTTCCTCATTCCTCGAGGAATGAGGAAAGGGACTTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183195.2-915s21c1
Sequence:CCGGGACGTTCAGTTCTAGTCTGACCTCGAGGTCAGACTAGAACTGAACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183195.2-404s21c1
Sequence:CCGGCATTGCCACCAGCAAGTACCACTCGAGTGGTACTTGCTGGTGGCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434830    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183195.2-1200s21c1
Sequence:CCGGAGCCTAGGGAGGTGTAGAATGCTCGAGCATTCTACACCTCCCTAGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183195.2-603s21c1
Sequence:CCGGATCATGATCGACCAGACGCAGCTCGAGCTGCGTCTGGTCGATCATGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031484
MARVELD1 MISSION shRNA Bacterial Glycerol Stock
MARVEL domain containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031484.1-1876s1c1
Sequence:CCGGCCACCTTAAGATTCCCAGCATCTCGAGATGCTGGGAATCTTAAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031484.1-1945s1c1
Sequence:CCGGGCTGTGTTCTGTTTGAAGATTCTCGAGAATCTTCAAACAGAACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031484.3-1078s21c1
Sequence:CCGGCAAATTGGAACCAGGCTTCTGCTCGAGCAGAAGCCTGGTTCCAATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031484.1-525s1c1
Sequence:CCGGCTACTGCAACCTCAAGGATTACTCGAGTAATCCTTGAGGTTGCAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154037    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031484.1-2663s1c1
Sequence:CCGGCCTTCTCAAGATCTCCTTCTTCTCGAGAAGAAGGAGATCTTGAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154241    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031484.1-2570s1c1
Sequence:CCGGCTGTACCCTAAACAGTGGATTCTCGAGAATCCACTGTTTAGGGTACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031484.3-511s21c1
Sequence:CCGGCATCATGAGCGACCAGATGCACTCGAGTGCATCTGGTCGCTCATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031484
MARVELD1 MISSION shRNA shRNA Plasmid DNA
MARVEL domain containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031484.1-1876s1c1
Sequence:CCGGCCACCTTAAGATTCCCAGCATCTCGAGATGCTGGGAATCTTAAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031484.1-1945s1c1
Sequence:CCGGGCTGTGTTCTGTTTGAAGATTCTCGAGAATCTTCAAACAGAACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031484.3-1078s21c1
Sequence:CCGGCAAATTGGAACCAGGCTTCTGCTCGAGCAGAAGCCTGGTTCCAATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031484.1-525s1c1
Sequence:CCGGCTACTGCAACCTCAAGGATTACTCGAGTAATCCTTGAGGTTGCAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154037    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031484.1-2663s1c1
Sequence:CCGGCCTTCTCAAGATCTCCTTCTTCTCGAGAAGAAGGAGATCTTGAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154241    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031484.1-2570s1c1
Sequence:CCGGCTGTACCCTAAACAGTGGATTCTCGAGAATCCACTGTTTAGGGTACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031484.3-511s21c1
Sequence:CCGGCATCATGAGCGACCAGATGCACTCGAGTGCATCTGGTCGCTCATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031484
MARVELD1 MISSION shRNA Lentiviral Transduction Particles
MARVEL domain containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031484.1-1876s1c1
Sequence:CCGGCCACCTTAAGATTCCCAGCATCTCGAGATGCTGGGAATCTTAAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031484.1-1945s1c1
Sequence:CCGGGCTGTGTTCTGTTTGAAGATTCTCGAGAATCTTCAAACAGAACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031484.3-1078s21c1
Sequence:CCGGCAAATTGGAACCAGGCTTCTGCTCGAGCAGAAGCCTGGTTCCAATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031484.1-525s1c1
Sequence:CCGGCTACTGCAACCTCAAGGATTACTCGAGTAATCCTTGAGGTTGCAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154037    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031484.1-2663s1c1
Sequence:CCGGCCTTCTCAAGATCTCCTTCTTCTCGAGAAGAAGGAGATCTTGAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154241    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031484.1-2570s1c1
Sequence:CCGGCTGTACCCTAAACAGTGGATTCTCGAGAATCCACTGTTTAGGGTACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031484.3-511s21c1
Sequence:CCGGCATCATGAGCGACCAGATGCACTCGAGTGCATCTGGTCGCTCATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)