EMAIL THIS PAGE TO A FRIEND

MARVELD2

MARVEL domain containing 2

176 Gene Product Result for
Synonyms: DFNB49 MARVD2 MRVLDC2 Tric
UniProtKB ID: Q8N4S9, A1BQX0, A1BQX1, A8KA97, Q96NM9
Gene ID:
Human(153562) Summary: The protein encoded by this gene is a membrane protein found at the tight junctions between epithelial cells. The encoded protein helps establish epithelial barriers such as those in the organ of Corti, where these barriers are required for normal hearing. Defects in this gene are a cause of deafness autosomal recessive type 49 (DFNB49). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Mouse(218518) MARVEL (membrane-associating) domain containing 2
Rat(365657) MARVEL domain containing 2
chicken(427393) MARVEL domain containing 2
domestic cat(101089075) MARVEL domain containing 2
cow(541110) MARVEL domain containing 2
Horse(100073307) MARVEL domain containing 2
dog(487240) MARVEL domain containing 2
naked mole-rat(101703498) MARVEL domain containing 2
Domestic Rabbit(100337735) MARVEL domain containing 2
domestic guinea pig(100726230) MARVEL domain containing 2
sheep(101118729) MARVEL domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178410 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178410 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178410 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144724 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144724 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144724 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001038603 Rosetta Predictions human pricing
NM_144724 Rosetta Predictions human pricing
NM_001108936 Rosetta Predictions rat pricing
NM_001038602 Rosetta Predictions mouse pricing
NM_178410 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244434 predicted 716
2 SASI_Hs01_00244435 predicted 1115
3 SASI_Hs02_00308394 predicted 544
4 SASI_Hs01_00244437 predicted 936
5 SASI_Hs01_00244439 predicted 255
6 SASI_Hs01_00244440 predicted 852
7 SASI_Hs01_00244441 predicted 842
8 SASI_Hs02_00308395 predicted 1084
9 SASI_Hs01_00244442 predicted 1076
10 SASI_Hs01_00244443 predicted 350
11 SASI_Hs01_00244436 predicted 934
12 SASI_Hs01_00244438 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144724 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027576 predicted 726
2 SASI_Hs01_00027577 predicted 1131
3 SASI_Hs02_00364674 predicted 559
4 SASI_Hs01_00027579 predicted 946
5 SASI_Hs01_00027581 predicted 268
6 SASI_Hs01_00027582 predicted 861
7 SASI_Hs01_00027583 predicted 854
8 SASI_Hs02_00364675 predicted 1095
9 SASI_Hs01_00027584 predicted 1081
10 SASI_Hs01_00027585 predicted 359
11 SASI_Hs01_00027578 predicted 944
12 SASI_Hs01_00027580 predicted 995
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108936 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243544 predicted 441
2 SASI_Rn02_00243545 predicted 1368
3 SASI_Rn02_00243546 predicted 1354
4 SASI_Rn02_00243547 predicted 1437
5 SASI_Rn02_00243548 predicted 1245
6 SASI_Rn02_00243549 predicted 326
7 SASI_Rn02_00243550 predicted 926
8 SASI_Rn02_00243551 predicted 1512
9 SASI_Rn02_00243552 predicted 1163
10 SASI_Rn02_00243553 predicted 1480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038602 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055182 predicted 904
2 SASI_Mm01_00055183 predicted 1653
3 SASI_Mm01_00055184 predicted 1390
4 SASI_Mm01_00055186 predicted 532
5 SASI_Mm02_00289616 predicted 1208
6 SASI_Mm01_00055187 predicted 952
7 SASI_Mm01_00055188 predicted 1575
8 SASI_Mm01_00055189 predicted 994
9 SASI_Mm01_00055190 predicted 1666
10 SASI_Mm01_00055191 predicted 336
11 SASI_Mm01_00055185 predicted 1034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178410 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041809 predicted 819
2 SASI_Mm01_00041810 predicted 610
3 SASI_Mm01_00041811 predicted 447
4 SASI_Mm02_00348851 predicted 191
5 SASI_Mm02_00348852 predicted 819
6 SASI_Mm01_00041812 predicted 364
7 SASI_Mm01_00041813 predicted 994
8 SASI_Mm01_00041814 predicted 675
9 SASI_Mm01_00041815 predicted 465
10 SASI_Mm02_00348853 predicted 803
11 SASI_Mm01_00041806 predicted 691
12 SASI_Mm01_00041807 predicted 593
13 SASI_Mm01_00041808 predicted 754
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178410
MARVELD2 MISSION shRNA Bacterial Glycerol Stock
MARVEL domain containing 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178410.2-461s21c1
Sequence:CCGGATACGATAAAGTGATGAATTGCTCGAGCAATTCATCACTTTATCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178410.2-493s21c1
Sequence:CCGGGTTATCCCTAGACACTGTTTACTCGAGTAAACAGTGTCTAGGGATAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178410.2-374s1c1
Sequence:CCGGGAAGAATGACCCTTCGTTTCTCTCGAGAGAAACGAAGGGTCATTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178410.2-459s1c1
Sequence:CCGGGAATACGATAAAGTGATGAATCTCGAGATTCATCACTTTATCGTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178410.2-412s1c1
Sequence:CCGGGCGATTACCTCAAGAACAAACCTCGAGGTTTGTTCTTGAGGTAATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178410.2-1671s21c1
Sequence:CCGGAGCTTAGGTTAGCGTTAAATTCTCGAGAATTTAACGCTAACCTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178410.2-182s21c1
Sequence:CCGGTGACGATCGAGAACGCTATAACTCGAGTTATAGCGTTCTCGATCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178410.2-412s21c1
Sequence:CCGGGCGATTACCTCAAGAACAAACCTCGAGGTTTGTTCTTGAGGTAATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197682    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178410.2-1274s1c1
Sequence:CCGGCCAGTCAAACAATTAACCAATCTCGAGATTGGTTAATTGTTTGACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178410
MARVELD2 MISSION shRNA shRNA Plasmid DNA
MARVEL domain containing 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178410.2-461s21c1
Sequence:CCGGATACGATAAAGTGATGAATTGCTCGAGCAATTCATCACTTTATCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178410.2-493s21c1
Sequence:CCGGGTTATCCCTAGACACTGTTTACTCGAGTAAACAGTGTCTAGGGATAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178410.2-374s1c1
Sequence:CCGGGAAGAATGACCCTTCGTTTCTCTCGAGAGAAACGAAGGGTCATTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178410.2-459s1c1
Sequence:CCGGGAATACGATAAAGTGATGAATCTCGAGATTCATCACTTTATCGTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178410.2-412s1c1
Sequence:CCGGGCGATTACCTCAAGAACAAACCTCGAGGTTTGTTCTTGAGGTAATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178410.2-1671s21c1
Sequence:CCGGAGCTTAGGTTAGCGTTAAATTCTCGAGAATTTAACGCTAACCTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178410.2-182s21c1
Sequence:CCGGTGACGATCGAGAACGCTATAACTCGAGTTATAGCGTTCTCGATCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178410.2-412s21c1
Sequence:CCGGGCGATTACCTCAAGAACAAACCTCGAGGTTTGTTCTTGAGGTAATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197682    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178410.2-1274s1c1
Sequence:CCGGCCAGTCAAACAATTAACCAATCTCGAGATTGGTTAATTGTTTGACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178410
MARVELD2 MISSION shRNA Lentiviral Transduction Particles
MARVEL domain containing 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178410.2-461s21c1
Sequence:CCGGATACGATAAAGTGATGAATTGCTCGAGCAATTCATCACTTTATCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178410.2-493s21c1
Sequence:CCGGGTTATCCCTAGACACTGTTTACTCGAGTAAACAGTGTCTAGGGATAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178410.2-374s1c1
Sequence:CCGGGAAGAATGACCCTTCGTTTCTCTCGAGAGAAACGAAGGGTCATTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178410.2-459s1c1
Sequence:CCGGGAATACGATAAAGTGATGAATCTCGAGATTCATCACTTTATCGTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178410.2-412s1c1
Sequence:CCGGGCGATTACCTCAAGAACAAACCTCGAGGTTTGTTCTTGAGGTAATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178410.2-1671s21c1
Sequence:CCGGAGCTTAGGTTAGCGTTAAATTCTCGAGAATTTAACGCTAACCTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178410.2-182s21c1
Sequence:CCGGTGACGATCGAGAACGCTATAACTCGAGTTATAGCGTTCTCGATCGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178410.2-412s21c1
Sequence:CCGGGCGATTACCTCAAGAACAAACCTCGAGGTTTGTTCTTGAGGTAATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197682    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178410.2-1274s1c1
Sequence:CCGGCCAGTCAAACAATTAACCAATCTCGAGATTGGTTAATTGTTTGACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144724
VALIDATED
MARVELD2 MISSION shRNA Bacterial Glycerol Stock
MARVEL domain containing 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_144724.1-610s1c1
Sequence:CCGGCCTGAGATACTCCTACATGAACTCGAGTTCATGTAGGAGTATCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_144724.1-989s1c1
Sequence:CCGGGCAGCCATAGTCTATGTGAATCTCGAGATTCACATAGACTATGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_144724.1-988s1c1
Sequence:CCGGCGCAGCCATAGTCTATGTGAACTCGAGTTCACATAGACTATGGCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_144724.1-1097s1c1
Sequence:CCGGGCTGCAATGATCTTCCTGTTTCTCGAGAAACAGGAAGATCATTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144724.1-2011s1c1
Sequence:CCGGGCAGCATCTATCATGTAGATACTCGAGTATCTACATGATAGATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144724
VALIDATED
MARVELD2 MISSION shRNA shRNA Plasmid DNA
MARVEL domain containing 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_144724.1-610s1c1
Sequence:CCGGCCTGAGATACTCCTACATGAACTCGAGTTCATGTAGGAGTATCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_144724.1-989s1c1
Sequence:CCGGGCAGCCATAGTCTATGTGAATCTCGAGATTCACATAGACTATGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_144724.1-988s1c1
Sequence:CCGGCGCAGCCATAGTCTATGTGAACTCGAGTTCACATAGACTATGGCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_144724.1-1097s1c1
Sequence:CCGGGCTGCAATGATCTTCCTGTTTCTCGAGAAACAGGAAGATCATTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144724.1-2011s1c1
Sequence:CCGGGCAGCATCTATCATGTAGATACTCGAGTATCTACATGATAGATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144724
VALIDATED
MARVELD2 MISSION shRNA Lentiviral Transduction Particles
MARVEL domain containing 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_144724.1-610s1c1
Sequence:CCGGCCTGAGATACTCCTACATGAACTCGAGTTCATGTAGGAGTATCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_144724.1-989s1c1
Sequence:CCGGGCAGCCATAGTCTATGTGAATCTCGAGATTCACATAGACTATGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_144724.1-988s1c1
Sequence:CCGGCGCAGCCATAGTCTATGTGAACTCGAGTTCACATAGACTATGGCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_144724.1-1097s1c1
Sequence:CCGGGCTGCAATGATCTTCCTGTTTCTCGAGAAACAGGAAGATCATTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072633    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144724.1-2011s1c1
Sequence:CCGGGCAGCATCTATCATGTAGATACTCGAGTATCTACATGATAGATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)