EMAIL THIS PAGE TO A FRIEND

MAS1

MAS1 oncogene

51 Gene Product Result for
Synonyms: MAS
UniProtKB ID: P04201, E1P5B3, Q2TBC9, Q6FG47
Gene ID:
Human(4142) Summary: This gene encodes a class I seven-transmembrane G-protein-coupled receptor. The encoded protein is a receptor for angiotensin-(1-7) and preferentially couples to the Gq protein, activating the phospholipase C signaling pathway. The encoded protein may play a role in multiple processes including hypotension, smooth muscle relaxation and cardioprotection by mediating the effects of angiotensin-(1-7). [provided by RefSeq, May 2012]
Mouse(17171) MAS1 oncogene
Rat(25153) MAS1 oncogene
chicken(428594) MAS1 oncogene
dog(484066) MAS1 oncogene
cow(783010) MAS1 oncogene
domestic cat(101094352) MAS1 oncogene
sheep(101112233) MAS1 oncogene
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002377 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002377 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002377 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008552 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008552 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008552 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU007611 MISSION® esiRNA esiRNA targeting mouse Mas1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002377 Rosetta Predictions human pricing
NM_012757 Rosetta Predictions rat pricing
NM_008552 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002377 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030549 predicted 223
2 SASI_Hs01_00030550 predicted 865
3 SASI_Hs01_00030551 predicted 271
4 SASI_Hs01_00030552 predicted 368
5 SASI_Hs01_00030553 predicted 708
6 SASI_Hs01_00030554 predicted 296
7 SASI_Hs01_00030555 predicted 277
8 SASI_Hs01_00030556 predicted 230
9 SASI_Hs01_00030557 predicted 283
10 SASI_Hs01_00030558 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012757 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030635 predicted 1292
2 SASI_Rn01_00030636 predicted 1558
3 SASI_Rn01_00030637 predicted 772
4 SASI_Rn01_00030638 predicted 1502
5 SASI_Rn01_00030639 predicted 697
6 SASI_Rn01_00030640 predicted 1465
7 SASI_Rn01_00030641 predicted 694
8 SASI_Rn01_00030642 predicted 1522
9 SASI_Rn01_00030643 predicted 1109
10 SASI_Rn01_00030644 predicted 807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008552 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166671 predicted 1719
2 SASI_Mm01_00166672 predicted 1889
3 SASI_Mm01_00166673 predicted 1160
4 SASI_Mm01_00166674 predicted 1947
5 SASI_Mm01_00166675 predicted 1126
6 SASI_Mm01_00166676 predicted 1632
7 SASI_Mm01_00166677 predicted 1126
8 SASI_Mm01_00166679 predicted 1411
9 SASI_Mm02_00314145 predicted 1991
10 SASI_Mm02_00314146 predicted 1205
11 SASI_Mm01_00166678 predicted 1550
12 SASI_Mm01_00166680 predicted 1563
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002377
MAS1 MISSION shRNA Bacterial Glycerol Stock
MAS1 oncogene
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002377.2-113s21c1
Sequence:CCGGCATCGTGCACTGGGTCATTATCTCGAGATAATGACCCAGTGCACGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002377.2-280s21c1
Sequence:CCGGTCGACTATGCTTTAGATTATGCTCGAGCATAATCTAAAGCATAGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002377.2-89s21c1
Sequence:CCGGCGGGAATGCACATCGGCAAATCTCGAGATTTGCCGATGTGCATTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002377.2-374s21c1
Sequence:CCGGCTATCTGCTGACGGCCATTAGCTCGAGCTAATGGCCGTCAGCAGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002377.2-565s1c1
Sequence:CCGGGCCGAGCAGTCATCATCTTTACTCGAGTAAAGATGATGACTGCTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002377.2-869s1c1
Sequence:CCGGCAGTAAGAAGAAGAGATTCAACTCGAGTTGAATCTCTTCTTCTTACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002377.2-944s1c1
Sequence:CCGGGCGCCAGAAAGACAATTGTAACTCGAGTTACAATTGTCTTTCTGGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002377.2-329s1c1
Sequence:CCGGTGTCACATTATCAGTGACTTTCTCGAGAAAGTCACTGATAATGTGACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002377.2-277s1c1
Sequence:CCGGCTATCGACTATGCTTTAGATTCTCGAGAATCTAAAGCATAGTCGATAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002377
MAS1 MISSION shRNA shRNA Plasmid DNA
MAS1 oncogene
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002377.2-113s21c1
Sequence:CCGGCATCGTGCACTGGGTCATTATCTCGAGATAATGACCCAGTGCACGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002377.2-280s21c1
Sequence:CCGGTCGACTATGCTTTAGATTATGCTCGAGCATAATCTAAAGCATAGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002377.2-89s21c1
Sequence:CCGGCGGGAATGCACATCGGCAAATCTCGAGATTTGCCGATGTGCATTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002377.2-374s21c1
Sequence:CCGGCTATCTGCTGACGGCCATTAGCTCGAGCTAATGGCCGTCAGCAGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002377.2-565s1c1
Sequence:CCGGGCCGAGCAGTCATCATCTTTACTCGAGTAAAGATGATGACTGCTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002377.2-869s1c1
Sequence:CCGGCAGTAAGAAGAAGAGATTCAACTCGAGTTGAATCTCTTCTTCTTACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002377.2-944s1c1
Sequence:CCGGGCGCCAGAAAGACAATTGTAACTCGAGTTACAATTGTCTTTCTGGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002377.2-329s1c1
Sequence:CCGGTGTCACATTATCAGTGACTTTCTCGAGAAAGTCACTGATAATGTGACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002377.2-277s1c1
Sequence:CCGGCTATCGACTATGCTTTAGATTCTCGAGAATCTAAAGCATAGTCGATAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002377
MAS1 MISSION shRNA Lentiviral Transduction Particles
MAS1 oncogene
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002377.2-113s21c1
Sequence:CCGGCATCGTGCACTGGGTCATTATCTCGAGATAATGACCCAGTGCACGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002377.2-280s21c1
Sequence:CCGGTCGACTATGCTTTAGATTATGCTCGAGCATAATCTAAAGCATAGTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002377.2-89s21c1
Sequence:CCGGCGGGAATGCACATCGGCAAATCTCGAGATTTGCCGATGTGCATTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002377.2-374s21c1
Sequence:CCGGCTATCTGCTGACGGCCATTAGCTCGAGCTAATGGCCGTCAGCAGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002377.2-565s1c1
Sequence:CCGGGCCGAGCAGTCATCATCTTTACTCGAGTAAAGATGATGACTGCTCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002377.2-869s1c1
Sequence:CCGGCAGTAAGAAGAAGAGATTCAACTCGAGTTGAATCTCTTCTTCTTACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002377.2-944s1c1
Sequence:CCGGGCGCCAGAAAGACAATTGTAACTCGAGTTACAATTGTCTTTCTGGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002377.2-329s1c1
Sequence:CCGGTGTCACATTATCAGTGACTTTCTCGAGAAAGTCACTGATAATGTGACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002377.2-277s1c1
Sequence:CCGGCTATCGACTATGCTTTAGATTCTCGAGAATCTAAAGCATAGTCGATAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008552
MAS1 MISSION shRNA Bacterial Glycerol Stock
MAS1 oncogene
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008552.2-1842s1c1
Sequence:CCGGCCAGGGCTTTCAAAGATGAAACTCGAGTTTCATCTTTGAAAGCCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008552.2-1201s1c1
Sequence:CCGGCCTGTCCATTGACTATGCTTTCTCGAGAAAGCATAGTCAATGGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008552.2-1258s1c1
Sequence:CCGGCGTGACATTATCGGTGACTTTCTCGAGAAAGTCACCGATAATGTCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008552.2-1143s1c1
Sequence:CCGGCGGTCTACATTACCCACTTGTCTCGAGACAAGTGGGTAATGTAGACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008552.2-1724s1c1
Sequence:CCGGCTGCATAACATCTCCTTGCTTCTCGAGAAGCAAGGAGATGTTATGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008552
MAS1 MISSION shRNA shRNA Plasmid DNA
MAS1 oncogene
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008552.2-1842s1c1
Sequence:CCGGCCAGGGCTTTCAAAGATGAAACTCGAGTTTCATCTTTGAAAGCCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008552.2-1201s1c1
Sequence:CCGGCCTGTCCATTGACTATGCTTTCTCGAGAAAGCATAGTCAATGGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008552.2-1258s1c1
Sequence:CCGGCGTGACATTATCGGTGACTTTCTCGAGAAAGTCACCGATAATGTCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008552.2-1143s1c1
Sequence:CCGGCGGTCTACATTACCCACTTGTCTCGAGACAAGTGGGTAATGTAGACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008552.2-1724s1c1
Sequence:CCGGCTGCATAACATCTCCTTGCTTCTCGAGAAGCAAGGAGATGTTATGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008552
MAS1 MISSION shRNA Lentiviral Transduction Particles
MAS1 oncogene
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008552.2-1842s1c1
Sequence:CCGGCCAGGGCTTTCAAAGATGAAACTCGAGTTTCATCTTTGAAAGCCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008552.2-1201s1c1
Sequence:CCGGCCTGTCCATTGACTATGCTTTCTCGAGAAAGCATAGTCAATGGACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008552.2-1258s1c1
Sequence:CCGGCGTGACATTATCGGTGACTTTCTCGAGAAAGTCACCGATAATGTCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008552.2-1143s1c1
Sequence:CCGGCGGTCTACATTACCCACTTGTCTCGAGACAAGTGGGTAATGTAGACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008552.2-1724s1c1
Sequence:CCGGCTGCATAACATCTCCTTGCTTCTCGAGAAGCAAGGAGATGTTATGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)