EMAIL THIS PAGE TO A FRIEND

MAS1L

MAS1 oncogene-like

23 Gene Product Result for
Synonyms: MAS-L MRG dJ994E9.2
Species: Human MAS1L(116511)
UniProtKB ID: P35410, Q5SUN5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052967 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052967 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052967 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052967 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124468 predicted 305
2 SASI_Hs02_00361780 predicted 647
3 SASI_Hs01_00124469 predicted 404
4 SASI_Hs02_00361781 predicted 655
5 SASI_Hs01_00124470 predicted 724
6 SASI_Hs01_00124471 predicted 347
7 SASI_Hs01_00124473 predicted 444
8 SASI_Hs01_00124474 predicted 777
9 SASI_Hs01_00124475 predicted 645
10 SASI_Hs01_00124476 predicted 389
11 SASI_Hs01_00124467 predicted 664
12 SASI_Hs01_00124472 predicted 705
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052967
MAS1L MISSION shRNA Bacterial Glycerol Stock
MAS1 oncogene-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052967.1-725s1c1
Sequence:CCGGCGAGTCTGACTCTACTCATTACTCGAGTAATGAGTAGAGTCAGACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052967.1-884s1c1
Sequence:CCGGCCTCCTATTTAATTTCCTTGTCTCGAGACAAGGAAATTAAATAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052967.1-435s1c1
Sequence:CCGGCCCTGATTTCCTGGCCATATTCTCGAGAATATGGCCAGGAAATCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052967.1-349s1c1
Sequence:CCGGGCTGCTGACGTGATCTATCTTCTCGAGAAGATAGATCACGTCAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052967.1-165s1c1
Sequence:CCGGGACGAATGAAACCATACATATCTCGAGATATGTATGGTTTCATTCGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052967.1-874s21c1
Sequence:CCGGTTTGTCACCACCTCCTATTTACTCGAGTAAATAGGAGGTGGTGACAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052967.1-347s21c1
Sequence:CCGGTCGCTGCTGACGTGATCTATCCTCGAGGATAGATCACGTCAGCAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052967.1-923s21c1
Sequence:CCGGGCGCCAACCCTATCATTTATTCTCGAGAATAAATGATAGGGTTGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052967
MAS1L MISSION shRNA shRNA Plasmid DNA
MAS1 oncogene-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052967.1-725s1c1
Sequence:CCGGCGAGTCTGACTCTACTCATTACTCGAGTAATGAGTAGAGTCAGACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052967.1-884s1c1
Sequence:CCGGCCTCCTATTTAATTTCCTTGTCTCGAGACAAGGAAATTAAATAGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052967.1-435s1c1
Sequence:CCGGCCCTGATTTCCTGGCCATATTCTCGAGAATATGGCCAGGAAATCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052967.1-349s1c1
Sequence:CCGGGCTGCTGACGTGATCTATCTTCTCGAGAAGATAGATCACGTCAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052967.1-165s1c1
Sequence:CCGGGACGAATGAAACCATACATATCTCGAGATATGTATGGTTTCATTCGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052967.1-874s21c1
Sequence:CCGGTTTGTCACCACCTCCTATTTACTCGAGTAAATAGGAGGTGGTGACAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052967.1-347s21c1
Sequence:CCGGTCGCTGCTGACGTGATCTATCCTCGAGGATAGATCACGTCAGCAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052967.1-923s21c1
Sequence:CCGGGCGCCAACCCTATCATTTATTCTCGAGAATAAATGATAGGGTTGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052967
MAS1L MISSION shRNA Lentiviral Transduction Particles
MAS1 oncogene-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052967.1-725s1c1
Sequence:CCGGCGAGTCTGACTCTACTCATTACTCGAGTAATGAGTAGAGTCAGACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052967.1-884s1c1
Sequence:CCGGCCTCCTATTTAATTTCCTTGTCTCGAGACAAGGAAATTAAATAGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052967.1-435s1c1
Sequence:CCGGCCCTGATTTCCTGGCCATATTCTCGAGAATATGGCCAGGAAATCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052967.1-349s1c1
Sequence:CCGGGCTGCTGACGTGATCTATCTTCTCGAGAAGATAGATCACGTCAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052967.1-165s1c1
Sequence:CCGGGACGAATGAAACCATACATATCTCGAGATATGTATGGTTTCATTCGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052967.1-874s21c1
Sequence:CCGGTTTGTCACCACCTCCTATTTACTCGAGTAAATAGGAGGTGGTGACAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052967.1-347s21c1
Sequence:CCGGTCGCTGCTGACGTGATCTATCCTCGAGGATAGATCACGTCAGCAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052967.1-923s21c1
Sequence:CCGGGCGCCAACCCTATCATTTATTCTCGAGAATAAATGATAGGGTTGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)