EMAIL THIS PAGE TO A FRIEND

MASP1

mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)

283 Gene Product Result for
Synonyms: 3MC1 CRARF CRARF1 MAP1 MASP MASP3 MAp44 PRSS5 RaRF
Gene ID:
Human(5648) Summary: This gene encodes a serine protease that functions as a component of the lectin pathway of complement activation. The complement pathway plays an essential role in the innate and adaptive immune response. The encoded protein is synthesized as a zymogen and is activated when it complexes with the pathogen recognition molecules of lectin pathway, the mannose-binding lectin and the ficolins. This protein is not directly involved in complement activation but may play a role as an amplifier of complement activation by cleaving complement C2 or by activating another complement serine protease, MASP-2. The encoded protein is also able to cleave fibrinogen and factor XIII and may may be involved in coagulation. A splice variant of this gene which lacks the serine protease domain functions as an inhibitor of the complement pathway. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010]
Mouse(17174) mannan-binding lectin serine peptidase 1
Rat(64023) mannan-binding lectin serine peptidase 1
naked mole-rat(101716867) mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)
domestic guinea pig(100730575) mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)
sheep(101111065) mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)
Zebrafish(100002060) mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)
cow(522347) mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)
Horse(100068261) mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)
domestic cat(101097166) mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)
dog(488121) mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)
chicken(407088) mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139125 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139125 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139125 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008555 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008555 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008555 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092381 MISSION® esiRNA esiRNA human MASP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031849 Rosetta Predictions human pricing
NM_001879 Rosetta Predictions human pricing
NM_139125 Rosetta Predictions human pricing
NM_022257 Rosetta Predictions rat pricing
NM_008555 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031849 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176720 predicted 460
2 SASI_Hs01_00176721 predicted 536
3 SASI_Hs01_00176722 predicted 1151
4 SASI_Hs01_00176723 predicted 425
5 SASI_Hs01_00176724 predicted 534
6 SASI_Hs01_00176725 predicted 674
7 SASI_Hs01_00176726 predicted 1009
8 SASI_Hs01_00176727 predicted 413
9 SASI_Hs01_00176728 predicted 964
10 SASI_Hs01_00176729 predicted 1122
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001879 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118078 predicted 455
2 SASI_Hs01_00118079 predicted 530
3 SASI_Hs01_00118080 predicted 1144
4 SASI_Hs01_00118081 predicted 426
5 SASI_Hs01_00118082 predicted 536
6 SASI_Hs01_00118083 predicted 675
7 SASI_Hs01_00118084 predicted 1000
8 SASI_Hs01_00118085 predicted 417
9 SASI_Hs01_00118086 predicted 959
10 SASI_Hs01_00118087 predicted 1121
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139125 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222887 predicted 462
2 SASI_Hs01_00222888 predicted 534
3 SASI_Hs01_00222889 predicted 1144
4 SASI_Hs01_00222890 predicted 424
5 SASI_Hs01_00222891 predicted 540
6 SASI_Hs01_00222892 predicted 671
7 SASI_Hs01_00222893 predicted 1004
8 SASI_Hs01_00222894 predicted 419
9 SASI_Hs01_00222895 predicted 962
10 SASI_Hs01_00222896 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022257 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041621 predicted 620
2 SASI_Rn01_00041622 predicted 2138
3 SASI_Rn01_00041623 predicted 1917
4 SASI_Rn01_00041624 predicted 2055
5 SASI_Rn01_00041625 predicted 1235
6 SASI_Rn02_00263046 predicted 1900
7 SASI_Rn01_00041626 predicted 1601
8 SASI_Rn01_00041627 predicted 904
9 SASI_Rn02_00263047 predicted 451
10 SASI_Rn01_00041628 predicted 1139
11 SASI_Rn01_00041620 predicted 1440
12 SASI_Rn01_00041629 predicted 1144
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008555 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020196 predicted 1384
2 SASI_Mm01_00020197 predicted 664
3 SASI_Mm01_00020198 predicted 1998
4 SASI_Mm01_00020199 predicted 844
5 SASI_Mm01_00020200 predicted 261
6 SASI_Mm01_00020201 predicted 2086
7 SASI_Mm01_00020202 predicted 281
8 SASI_Mm01_00020203 predicted 249
9 SASI_Mm01_00020205 predicted 1262
10 SASI_Mm02_00314147 predicted 388
11 SASI_Mm01_00020204 predicted 962
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139125
VALIDATED
MASP1 MISSION shRNA Bacterial Glycerol Stock
mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139125.2-2578s21c1
Sequence:CCGGAGCACACTCCACATTACTTATCTCGAGATAAGTAATGTGGAGTGTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139125.2-494s21c1
Sequence:CCGGTGGGTTTCGGATCAAGCTTTACTCGAGTAAAGCTTGATCCGAAACCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139125.1-1055s1c1
Sequence:CCGGGCTGAAGGATAATGTGGAGATCTCGAGATCTCCACATTATCCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139125.1-172s1c1
Sequence:CCGGCCAGTGATTCAGAGGTGACTTCTCGAGAAGTCACCTCTGAATCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139125.1-394s1c1
Sequence:CCGGCCATCACTTTCCGGTCAGATTCTCGAGAATCTGACCGGAAAGTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139125.1-1473s1c1
Sequence:CCGGGTGCCAAATGACAAGTGGTTTCTCGAGAAACCACTTGTCATTTGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139125.1-1247s1c1
Sequence:CCGGGCCCTATTACAAGATGCTCAACTCGAGTTGAGCATCTTGTAATAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139125
VALIDATED
MASP1 MISSION shRNA shRNA Plasmid DNA
mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139125.2-2578s21c1
Sequence:CCGGAGCACACTCCACATTACTTATCTCGAGATAAGTAATGTGGAGTGTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139125.2-494s21c1
Sequence:CCGGTGGGTTTCGGATCAAGCTTTACTCGAGTAAAGCTTGATCCGAAACCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139125.1-1055s1c1
Sequence:CCGGGCTGAAGGATAATGTGGAGATCTCGAGATCTCCACATTATCCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139125.1-172s1c1
Sequence:CCGGCCAGTGATTCAGAGGTGACTTCTCGAGAAGTCACCTCTGAATCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139125.1-394s1c1
Sequence:CCGGCCATCACTTTCCGGTCAGATTCTCGAGAATCTGACCGGAAAGTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139125.1-1473s1c1
Sequence:CCGGGTGCCAAATGACAAGTGGTTTCTCGAGAAACCACTTGTCATTTGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139125.1-1247s1c1
Sequence:CCGGGCCCTATTACAAGATGCTCAACTCGAGTTGAGCATCTTGTAATAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139125
VALIDATED
MASP1 MISSION shRNA Lentiviral Transduction Particles
mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139125.2-2578s21c1
Sequence:CCGGAGCACACTCCACATTACTTATCTCGAGATAAGTAATGTGGAGTGTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139125.2-494s21c1
Sequence:CCGGTGGGTTTCGGATCAAGCTTTACTCGAGTAAAGCTTGATCCGAAACCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139125.1-1055s1c1
Sequence:CCGGGCTGAAGGATAATGTGGAGATCTCGAGATCTCCACATTATCCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139125.1-172s1c1
Sequence:CCGGCCAGTGATTCAGAGGTGACTTCTCGAGAAGTCACCTCTGAATCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139125.1-394s1c1
Sequence:CCGGCCATCACTTTCCGGTCAGATTCTCGAGAATCTGACCGGAAAGTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139125.1-1473s1c1
Sequence:CCGGGTGCCAAATGACAAGTGGTTTCTCGAGAAACCACTTGTCATTTGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_139125.1-1247s1c1
Sequence:CCGGGCCCTATTACAAGATGCTCAACTCGAGTTGAGCATCTTGTAATAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008555
MASP1 MISSION shRNA Bacterial Glycerol Stock
mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008555.1-172s1c1
Sequence:CCGGGCTATCCAGATTCCTATCCAACTCGAGTTGGATAGGAATCTGGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008555.1-131s1c1
Sequence:CCGGCGTGGAGCTAAACGAAATGTTCTCGAGAACATTTCGTTTAGCTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008555.1-1228s1c1
Sequence:CCGGCCACATACAAATCTGAGATAACTCGAGTTATCTCAGATTTGTATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008555.1-790s1c1
Sequence:CCGGCCTGTCCCTATGACTACATTACTCGAGTAATGTAGTCATAGGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008555.1-1860s1c1
Sequence:CCGGCCAGAGAACCTGATGGAGATTCTCGAGAATCTCCATCAGGTTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008555
MASP1 MISSION shRNA shRNA Plasmid DNA
mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008555.1-172s1c1
Sequence:CCGGGCTATCCAGATTCCTATCCAACTCGAGTTGGATAGGAATCTGGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008555.1-131s1c1
Sequence:CCGGCGTGGAGCTAAACGAAATGTTCTCGAGAACATTTCGTTTAGCTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008555.1-1228s1c1
Sequence:CCGGCCACATACAAATCTGAGATAACTCGAGTTATCTCAGATTTGTATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008555.1-790s1c1
Sequence:CCGGCCTGTCCCTATGACTACATTACTCGAGTAATGTAGTCATAGGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008555.1-1860s1c1
Sequence:CCGGCCAGAGAACCTGATGGAGATTCTCGAGAATCTCCATCAGGTTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008555
MASP1 MISSION shRNA Lentiviral Transduction Particles
mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008555.1-172s1c1
Sequence:CCGGGCTATCCAGATTCCTATCCAACTCGAGTTGGATAGGAATCTGGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008555.1-131s1c1
Sequence:CCGGCGTGGAGCTAAACGAAATGTTCTCGAGAACATTTCGTTTAGCTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008555.1-1228s1c1
Sequence:CCGGCCACATACAAATCTGAGATAACTCGAGTTATCTCAGATTTGTATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008555.1-790s1c1
Sequence:CCGGCCTGTCCCTATGACTACATTACTCGAGTAATGTAGTCATAGGGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008555.1-1860s1c1
Sequence:CCGGCCAGAGAACCTGATGGAGATTCTCGAGAATCTCCATCAGGTTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)