EMAIL THIS PAGE TO A FRIEND

MASP2

mannan-binding lectin serine peptidase 2

88 Gene Product Result for
Synonyms: MAP19 MASP-2 MASP1P1 sMAP
Gene ID:
Human(10747) Summary: The Ra-reactive factor (RARF) is a complement-dependent bactericidal factor that binds to the Ra and R2 polysaccharides expressed by certain enterobacteria. Alternate splicing of this gene results in two transcript variants encoding two RARF components that are involved in the mannan-binding lectin pathway of complement activation. The longer isoform is cleaved into two chains which form a heterodimer linked by a disulfide bond. The encoded proteins are members of the trypsin family of peptidases. [provided by RefSeq, Jul 2008]
Mouse(17175) mannan-binding lectin serine peptidase 2
Rat(64459) mannan-binding lectin serine peptidase 2
Zebrafish(560277) mannan-binding lectin serine peptidase 2
dog(487447) mannan-binding lectin serine peptidase 2
Horse(100056770) mannan-binding lectin serine peptidase 2
cow(505819) mannan-binding lectin serine peptidase 2
domestic cat(101099568) mannan-binding lectin serine peptidase 2
chicken(407089) mannan-binding lectin serine peptidase 2
sheep(101112586) mannan-binding lectin serine peptidase 2
domestic guinea pig(100725747) mannan-binding lectin serine peptidase 2
naked mole-rat(101696699) mannan-binding lectin serine peptidase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006610 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006610 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006610 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_358353 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_358353 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_358353 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006610 Rosetta Predictions human pricing
NM_139208 Rosetta Predictions human pricing
NM_172043 Rosetta Predictions rat pricing
NM_001003893 Rosetta Predictions mouse pricing
NM_010767 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006610 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137884 predicted 228
2 SASI_Hs01_00137885 predicted 219
3 SASI_Hs01_00137886 predicted 226
4 SASI_Hs01_00137887 predicted 224
5 SASI_Hs01_00137888 predicted 231
6 SASI_Hs02_00341941 predicted 343
7 SASI_Hs01_00137889 predicted 283
8 SASI_Hs01_00137890 predicted 197
9 SASI_Hs01_00137891 predicted 222
10 SASI_Hs01_00137893 predicted 213
11 SASI_Hs01_00137892 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139208 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096414 predicted 231
2 SASI_Hs01_00096415 predicted 223
3 SASI_Hs01_00096416 predicted 221
4 SASI_Hs01_00096417 predicted 229
5 SASI_Hs01_00096418 predicted 232
6 SASI_Hs02_00364232 predicted 343
7 SASI_Hs01_00096419 predicted 283
8 SASI_Hs01_00096420 predicted 205
9 SASI_Hs01_00096421 predicted 217
10 SASI_Hs01_00096423 predicted 221
11 SASI_Hs01_00096422 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172043 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269151 predicted 722
2 SASI_Rn01_00054433 predicted 831
3 SASI_Rn01_00054434 predicted 937
4 SASI_Rn02_00269152 predicted 216
5 SASI_Rn01_00054435 predicted 1785
6 SASI_Rn01_00054436 predicted 1619
7 SASI_Rn01_00054437 predicted 1223
8 SASI_Rn01_00054438 predicted 1798
9 SASI_Rn01_00054439 predicted 1782
10 SASI_Rn01_00054440 predicted 1098
11 SASI_Rn01_00054431 predicted 1393
12 SASI_Rn01_00054432 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003893 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147742 predicted 196
2 SASI_Mm01_00147743 predicted 255
3 SASI_Mm01_00147744 predicted 246
4 SASI_Mm01_00147746 predicted 242
5 SASI_Mm01_00147747 predicted 251
6 SASI_Mm01_00147748 predicted 212
7 SASI_Mm01_00147749 predicted 210
8 SASI_Mm02_00286340 predicted 297
9 SASI_Mm01_00147750 predicted 327
10 SASI_Mm02_00286341 predicted 214
11 SASI_Mm01_00147745 predicted 333
12 SASI_Mm01_00147751 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010767 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058685 predicted 196
2 SASI_Mm01_00058686 predicted 250
3 SASI_Mm01_00058687 predicted 247
4 SASI_Mm01_00058689 predicted 240
5 SASI_Mm01_00058690 predicted 255
6 SASI_Mm01_00058691 predicted 211
7 SASI_Mm01_00058692 predicted 210
8 SASI_Mm02_00319305 predicted 302
9 SASI_Mm01_00058693 predicted 335
10 SASI_Mm02_00319306 predicted 208
11 SASI_Mm01_00058688 predicted 336
12 SASI_Mm01_00058694 predicted 350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006610
MASP2 MISSION shRNA Bacterial Glycerol Stock
mannan-binding lectin serine peptidase 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006610.2-1667s1c1
Sequence:CCGGCGCCTATTTGTCTGCCAAGAACTCGAGTTCTTGGCAGACAAATAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006610.2-1600s1c1
Sequence:CCGGGCTGGCTTTGACAATGACATACTCGAGTATGTCATTGTCAAAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006610.2-1390s1c1
Sequence:CCGGCCTTGGCAAGTCCTGATATTACTCGAGTAATATCAGGACTTGCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006610.2-192s1c1
Sequence:CCGGGCGCCTCTACTTCACCCACTTCTCGAGAAGTGGGTGAAGTAGAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006610.2-963s1c1
Sequence:CCGGGCAAGCCAAATACATCCTGAACTCGAGTTCAGGATGTATTTGGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006610.2-925s21c1
Sequence:CCGGTATCCGATGGCGCCACCTAATCTCGAGATTAGGTGGCGCCATCGGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006610.2-1169s21c1
Sequence:CCGGCTGGAGTGACCACCTACAAAGCTCGAGCTTTGTAGGTGGTCACTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006610.2-1338s21c1
Sequence:CCGGCACAACAGGAGGGCGTATATACTCGAGTATATACGCCCTCCTGTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006610
MASP2 MISSION shRNA shRNA Plasmid DNA
mannan-binding lectin serine peptidase 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006610.2-1667s1c1
Sequence:CCGGCGCCTATTTGTCTGCCAAGAACTCGAGTTCTTGGCAGACAAATAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006610.2-1600s1c1
Sequence:CCGGGCTGGCTTTGACAATGACATACTCGAGTATGTCATTGTCAAAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006610.2-1390s1c1
Sequence:CCGGCCTTGGCAAGTCCTGATATTACTCGAGTAATATCAGGACTTGCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006610.2-192s1c1
Sequence:CCGGGCGCCTCTACTTCACCCACTTCTCGAGAAGTGGGTGAAGTAGAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006610.2-963s1c1
Sequence:CCGGGCAAGCCAAATACATCCTGAACTCGAGTTCAGGATGTATTTGGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006610.2-925s21c1
Sequence:CCGGTATCCGATGGCGCCACCTAATCTCGAGATTAGGTGGCGCCATCGGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006610.2-1169s21c1
Sequence:CCGGCTGGAGTGACCACCTACAAAGCTCGAGCTTTGTAGGTGGTCACTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006610.2-1338s21c1
Sequence:CCGGCACAACAGGAGGGCGTATATACTCGAGTATATACGCCCTCCTGTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006610
MASP2 MISSION shRNA Lentiviral Transduction Particles
mannan-binding lectin serine peptidase 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006610.2-1667s1c1
Sequence:CCGGCGCCTATTTGTCTGCCAAGAACTCGAGTTCTTGGCAGACAAATAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006610.2-1600s1c1
Sequence:CCGGGCTGGCTTTGACAATGACATACTCGAGTATGTCATTGTCAAAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006610.2-1390s1c1
Sequence:CCGGCCTTGGCAAGTCCTGATATTACTCGAGTAATATCAGGACTTGCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006610.2-192s1c1
Sequence:CCGGGCGCCTCTACTTCACCCACTTCTCGAGAAGTGGGTGAAGTAGAGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006610.2-963s1c1
Sequence:CCGGGCAAGCCAAATACATCCTGAACTCGAGTTCAGGATGTATTTGGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006610.2-925s21c1
Sequence:CCGGTATCCGATGGCGCCACCTAATCTCGAGATTAGGTGGCGCCATCGGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006610.2-1169s21c1
Sequence:CCGGCTGGAGTGACCACCTACAAAGCTCGAGCTTTGTAGGTGGTCACTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006610.2-1338s21c1
Sequence:CCGGCACAACAGGAGGGCGTATATACTCGAGTATATACGCCCTCCTGTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_358353
MASP2 MISSION shRNA Bacterial Glycerol Stock
mannan-binding lectin serine peptidase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358353.1-204s1c1
Sequence:CCGGCGCCTCTACTTCACCCACTTTCTCGAGAAAGTGGGTGAAGTAGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358353.1-138s1c1
Sequence:CCGGCCAGAGAAGTATGCTGACCATCTCGAGATGGTCAGCATACTTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358353.1-248s1c1
Sequence:CCGGCGAGTATGACTTTGTCAAGTTCTCGAGAACTTGACAAAGTCATACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358353.1-478s1c1
Sequence:CCGGCAGTCCCTTGTGACCATTATTCTCGAGAATAATGGTCACAAGGGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358353.1-386s1c1
Sequence:CCGGCTCCGACTACTCCAATGAGAACTCGAGTTCTCATTGGAGTAGTCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_358353
MASP2 MISSION shRNA shRNA Plasmid DNA
mannan-binding lectin serine peptidase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358353.1-204s1c1
Sequence:CCGGCGCCTCTACTTCACCCACTTTCTCGAGAAAGTGGGTGAAGTAGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358353.1-138s1c1
Sequence:CCGGCCAGAGAAGTATGCTGACCATCTCGAGATGGTCAGCATACTTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358353.1-248s1c1
Sequence:CCGGCGAGTATGACTTTGTCAAGTTCTCGAGAACTTGACAAAGTCATACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358353.1-478s1c1
Sequence:CCGGCAGTCCCTTGTGACCATTATTCTCGAGAATAATGGTCACAAGGGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358353.1-386s1c1
Sequence:CCGGCTCCGACTACTCCAATGAGAACTCGAGTTCTCATTGGAGTAGTCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_358353
MASP2 MISSION shRNA Lentiviral Transduction Particles
mannan-binding lectin serine peptidase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358353.1-204s1c1
Sequence:CCGGCGCCTCTACTTCACCCACTTTCTCGAGAAAGTGGGTGAAGTAGAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358353.1-138s1c1
Sequence:CCGGCCAGAGAAGTATGCTGACCATCTCGAGATGGTCAGCATACTTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358353.1-248s1c1
Sequence:CCGGCGAGTATGACTTTGTCAAGTTCTCGAGAACTTGACAAAGTCATACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358353.1-478s1c1
Sequence:CCGGCAGTCCCTTGTGACCATTATTCTCGAGAATAATGGTCACAAGGGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358353.1-386s1c1
Sequence:CCGGCTCCGACTACTCCAATGAGAACTCGAGTTCTCATTGGAGTAGTCGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)