EMAIL THIS PAGE TO A FRIEND

MAST1

microtubule associated serine/threonine kinase 1

96 Gene Product Result for
Synonyms: SAST SAST170
UniProtKB ID: Q9Y2H9, O00114, Q8N6X0
Gene ID:
Mouse(56527) microtubule associated serine/threonine kinase 1
Rat(353118) microtubule associated serine/threonine kinase 1
sheep(101122693) microtubule associated serine/threonine kinase 1
domestic guinea pig(100729258) microtubule associated serine/threonine kinase 1
naked mole-rat(101713958) microtubule associated serine/threonine kinase 1
domestic cat(101093084) microtubule associated serine/threonine kinase 1
dog(100682579) microtubule associated serine/threonine kinase 1
cow(539825) microtubule associated serine/threonine kinase 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014975 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014975 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014975 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019945 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019945 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019945 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014975 Rosetta Predictions human pricing
NM_181089 Rosetta Predictions rat pricing
NM_019945 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014975 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239193 predicted 2125
2 SASI_Hs01_00239194 predicted 638
3 SASI_Hs01_00239195 predicted 1157
4 SASI_Hs01_00239196 predicted 855
5 SASI_Hs01_00239197 predicted 1328
6 SASI_Hs01_00239198 predicted 2988
7 SASI_Hs01_00239199 predicted 560
8 SASI_Hs01_00239202 predicted 747
9 SASI_Hs02_00346689 predicted 3641
10 SASI_Hs02_00346690 predicted 3299
11 SASI_Hs01_00239200 predicted 3859
12 SASI_Hs01_00239201 predicted 3018
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181089 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056834 predicted 3299
2 SASI_Rn01_00056836 predicted 1719
3 SASI_Rn01_00056837 predicted 1528
4 SASI_Rn01_00056838 predicted 2008
5 SASI_Rn01_00056839 predicted 2040
6 SASI_Rn01_00056840 predicted 2872
7 SASI_Rn01_00056841 predicted 1460
8 SASI_Rn01_00056842 predicted 2434
9 SASI_Rn02_00269672 predicted 1458
10 SASI_Rn02_00269673 predicted 1103
11 SASI_Rn01_00056835 predicted 3467
12 SASI_Rn01_00056843 predicted 1170
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019945 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051123 predicted 1275
2 SASI_Mm01_00051124 predicted 264
3 SASI_Mm02_00325242 predicted 1413
4 SASI_Mm01_00051125 predicted 1603
5 SASI_Mm01_00051126 predicted 1368
6 SASI_Mm01_00051127 predicted 1191
7 SASI_Mm02_00325243 predicted 3541
8 SASI_Mm02_00325244 predicted 3520
9 SASI_Mm01_00051129 predicted 1354
10 SASI_Mm01_00051132 predicted 4306
11 SASI_Mm01_00051128 predicted 653
12 SASI_Mm01_00051130 predicted 3330
13 SASI_Mm01_00051131 predicted 226
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014975
VALIDATED
MAST1 MISSION shRNA Bacterial Glycerol Stock
microtubule associated serine/threonine kinase 1
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014975.2-1897s21c1
Sequence:CCGGACACACCAGAGGAGCTATTTGCTCGAGCAAATAGCTCCTCTGGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014975.1-1483s21c1
Sequence:CCGGGTGCTAGCCCTGGAGTATTTGCTCGAGCAAATACTCCAGGGCTAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014975.1-3145s1c1
Sequence:CCGGGTCGTGGAGCTGATCCTTAAGCTCGAGCTTAAGGATCAGCTCCACGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014975.1-1968s1c1
Sequence:CCGGGCACAGTTTCTTTCGAGACCTCTCGAGAGGTCTCGAAAGAAACTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014975.1-761s1c1
Sequence:CCGGCCACGGTCTACTTCTATGAATCTCGAGATTCATAGAAGTAGACCGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014975.1-3235s1c1
Sequence:CCGGCGCAGCAGCTACAAGGCTAAACTCGAGTTTAGCCTTGTAGCTGCTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014975.1-564s1c1
Sequence:CCGGCGTGATGATGAATCACGTCTACTCGAGTAGACGTGATTCATCATCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014975.2-646s21c1
Sequence:CCGGACGAGATCGTGATGATGAATCCTCGAGGATTCATCATCACGATCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014975.1-1160s21c1
Sequence:CCGGTCGATACCATCAAGCTCATAACTCGAGTTATGAGCTTGATGGTATCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014975.2-709s21c1
Sequence:CCGGAGGAGAAGCTGCGCGACTTTACTCGAGTAAAGTCGCGCAGCTTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014975.1-2166s21c1
Sequence:CCGGGCGCTTCAGCAAGGTGTATAGCTCGAGCTATACACCTTGCTGAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014975.1-1610s21c1
Sequence:CCGGTGAGCCTCACCACCAACTTATCTCGAGATAAGTTGGTGGTGAGGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_014975.1-1294s1c1
Sequence:CCGGGCCTTTGTGGAGCGCGATATCCTCGAGGATATCGCGCTCCACAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014975.1-862s1c1
Sequence:CCGGGTGAAGAAGTTGCTTATTATCCTCGAGGATAATAAGCAACTTCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014975.1-4336s1c1
Sequence:CCGGCTGGTACCCATTGTCGTAGAGCTCGAGCTCTACGACAATGGGTACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014975.1-2166s1c1
Sequence:CCGGGCGCTTCAGCAAGGTGTATAGCTCGAGCTATACACCTTGCTGAAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014975.1-860s21c1
Sequence:CCGGTGGTGAAGAAGTTGCTTATTACTCGAGTAATAAGCAACTTCTTCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014975
VALIDATED
MAST1 MISSION shRNA shRNA Plasmid DNA
microtubule associated serine/threonine kinase 1
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014975.2-1897s21c1
Sequence:CCGGACACACCAGAGGAGCTATTTGCTCGAGCAAATAGCTCCTCTGGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014975.1-1483s21c1
Sequence:CCGGGTGCTAGCCCTGGAGTATTTGCTCGAGCAAATACTCCAGGGCTAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014975.1-3145s1c1
Sequence:CCGGGTCGTGGAGCTGATCCTTAAGCTCGAGCTTAAGGATCAGCTCCACGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014975.1-1968s1c1
Sequence:CCGGGCACAGTTTCTTTCGAGACCTCTCGAGAGGTCTCGAAAGAAACTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014975.1-761s1c1
Sequence:CCGGCCACGGTCTACTTCTATGAATCTCGAGATTCATAGAAGTAGACCGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014975.1-3235s1c1
Sequence:CCGGCGCAGCAGCTACAAGGCTAAACTCGAGTTTAGCCTTGTAGCTGCTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014975.1-564s1c1
Sequence:CCGGCGTGATGATGAATCACGTCTACTCGAGTAGACGTGATTCATCATCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014975.2-646s21c1
Sequence:CCGGACGAGATCGTGATGATGAATCCTCGAGGATTCATCATCACGATCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014975.1-1160s21c1
Sequence:CCGGTCGATACCATCAAGCTCATAACTCGAGTTATGAGCTTGATGGTATCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014975.2-709s21c1
Sequence:CCGGAGGAGAAGCTGCGCGACTTTACTCGAGTAAAGTCGCGCAGCTTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014975.1-2166s21c1
Sequence:CCGGGCGCTTCAGCAAGGTGTATAGCTCGAGCTATACACCTTGCTGAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014975.1-1610s21c1
Sequence:CCGGTGAGCCTCACCACCAACTTATCTCGAGATAAGTTGGTGGTGAGGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_014975.1-1294s1c1
Sequence:CCGGGCCTTTGTGGAGCGCGATATCCTCGAGGATATCGCGCTCCACAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014975.1-862s1c1
Sequence:CCGGGTGAAGAAGTTGCTTATTATCCTCGAGGATAATAAGCAACTTCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014975.1-4336s1c1
Sequence:CCGGCTGGTACCCATTGTCGTAGAGCTCGAGCTCTACGACAATGGGTACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014975.1-2166s1c1
Sequence:CCGGGCGCTTCAGCAAGGTGTATAGCTCGAGCTATACACCTTGCTGAAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014975.1-860s21c1
Sequence:CCGGTGGTGAAGAAGTTGCTTATTACTCGAGTAATAAGCAACTTCTTCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014975
VALIDATED
MAST1 MISSION shRNA Lentiviral Transduction Particles
microtubule associated serine/threonine kinase 1
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014975.2-1897s21c1
Sequence:CCGGACACACCAGAGGAGCTATTTGCTCGAGCAAATAGCTCCTCTGGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014975.1-1483s21c1
Sequence:CCGGGTGCTAGCCCTGGAGTATTTGCTCGAGCAAATACTCCAGGGCTAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014975.1-3145s1c1
Sequence:CCGGGTCGTGGAGCTGATCCTTAAGCTCGAGCTTAAGGATCAGCTCCACGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014975.1-1968s1c1
Sequence:CCGGGCACAGTTTCTTTCGAGACCTCTCGAGAGGTCTCGAAAGAAACTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014975.1-761s1c1
Sequence:CCGGCCACGGTCTACTTCTATGAATCTCGAGATTCATAGAAGTAGACCGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014975.1-3235s1c1
Sequence:CCGGCGCAGCAGCTACAAGGCTAAACTCGAGTTTAGCCTTGTAGCTGCTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014975.1-564s1c1
Sequence:CCGGCGTGATGATGAATCACGTCTACTCGAGTAGACGTGATTCATCATCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014975.2-646s21c1
Sequence:CCGGACGAGATCGTGATGATGAATCCTCGAGGATTCATCATCACGATCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014975.1-1160s21c1
Sequence:CCGGTCGATACCATCAAGCTCATAACTCGAGTTATGAGCTTGATGGTATCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014975.2-709s21c1
Sequence:CCGGAGGAGAAGCTGCGCGACTTTACTCGAGTAAAGTCGCGCAGCTTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014975.1-2166s21c1
Sequence:CCGGGCGCTTCAGCAAGGTGTATAGCTCGAGCTATACACCTTGCTGAAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014975.1-1610s21c1
Sequence:CCGGTGAGCCTCACCACCAACTTATCTCGAGATAAGTTGGTGGTGAGGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_014975.1-1294s1c1
Sequence:CCGGGCCTTTGTGGAGCGCGATATCCTCGAGGATATCGCGCTCCACAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014975.1-862s1c1
Sequence:CCGGGTGAAGAAGTTGCTTATTATCCTCGAGGATAATAAGCAACTTCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014975.1-4336s1c1
Sequence:CCGGCTGGTACCCATTGTCGTAGAGCTCGAGCTCTACGACAATGGGTACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014975.1-2166s1c1
Sequence:CCGGGCGCTTCAGCAAGGTGTATAGCTCGAGCTATACACCTTGCTGAAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014975.1-860s21c1
Sequence:CCGGTGGTGAAGAAGTTGCTTATTACTCGAGTAATAAGCAACTTCTTCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019945
MAST1 MISSION shRNA Bacterial Glycerol Stock
microtubule associated serine/threonine kinase 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019945.1-3261s1c1
Sequence:CCGGCGCAGCAGTTACAAAGCCAAACTCGAGTTTGGCTTTGTAACTGCTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019945.1-945s1c1
Sequence:CCGGCCAGAAGAGTTCTACCACCTTCTCGAGAAGGTGGTAGAACTCTTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019945.1-227s1c1
Sequence:CCGGCCACTTAGGTAGCAGTCCTTTCTCGAGAAAGGACTGCTACCTAAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019945.1-1919s1c1
Sequence:CCGGGCTTCTAATATCTAGCCTCTTCTCGAGAAGAGGCTAGATATTAGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019945.1-2785s1c1
Sequence:CCGGGCAAAGTTATCAAGTCGGCTTCTCGAGAAGCCGACTTGATAACTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019945.2-141s21c1
Sequence:CCGGTGTTTCGCCGCACCAAGAGTTCTCGAGAACTCTTGGTGCGGCGAAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019945.2-581s21c1
Sequence:CCGGTCCTCCTACGACAACGAAATTCTCGAGAATTTCGTTGTCGTAGGAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019945
MAST1 MISSION shRNA shRNA Plasmid DNA
microtubule associated serine/threonine kinase 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019945.1-3261s1c1
Sequence:CCGGCGCAGCAGTTACAAAGCCAAACTCGAGTTTGGCTTTGTAACTGCTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019945.1-945s1c1
Sequence:CCGGCCAGAAGAGTTCTACCACCTTCTCGAGAAGGTGGTAGAACTCTTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019945.1-227s1c1
Sequence:CCGGCCACTTAGGTAGCAGTCCTTTCTCGAGAAAGGACTGCTACCTAAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019945.1-1919s1c1
Sequence:CCGGGCTTCTAATATCTAGCCTCTTCTCGAGAAGAGGCTAGATATTAGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019945.1-2785s1c1
Sequence:CCGGGCAAAGTTATCAAGTCGGCTTCTCGAGAAGCCGACTTGATAACTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019945.2-141s21c1
Sequence:CCGGTGTTTCGCCGCACCAAGAGTTCTCGAGAACTCTTGGTGCGGCGAAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019945.2-581s21c1
Sequence:CCGGTCCTCCTACGACAACGAAATTCTCGAGAATTTCGTTGTCGTAGGAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019945
MAST1 MISSION shRNA Lentiviral Transduction Particles
microtubule associated serine/threonine kinase 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019945.1-3261s1c1
Sequence:CCGGCGCAGCAGTTACAAAGCCAAACTCGAGTTTGGCTTTGTAACTGCTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019945.1-945s1c1
Sequence:CCGGCCAGAAGAGTTCTACCACCTTCTCGAGAAGGTGGTAGAACTCTTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019945.1-227s1c1
Sequence:CCGGCCACTTAGGTAGCAGTCCTTTCTCGAGAAAGGACTGCTACCTAAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019945.1-1919s1c1
Sequence:CCGGGCTTCTAATATCTAGCCTCTTCTCGAGAAGAGGCTAGATATTAGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019945.1-2785s1c1
Sequence:CCGGGCAAAGTTATCAAGTCGGCTTCTCGAGAAGCCGACTTGATAACTTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019945.2-141s21c1
Sequence:CCGGTGTTTCGCCGCACCAAGAGTTCTCGAGAACTCTTGGTGCGGCGAAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019945.2-581s21c1
Sequence:CCGGTCCTCCTACGACAACGAAATTCTCGAGAATTTCGTTGTCGTAGGAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)