EMAIL THIS PAGE TO A FRIEND

MAST4

microtubule associated serine/threonine kinase family member 4

157 Gene Product Result for
Gene ID:
Mouse(328329) microtubule associated serine/threonine kinase family member 4
Rat(310040) microtubule associated serine/threonine kinase family member 4
Zebrafish(100149322) microtubule associated serine/threonine kinase family member 4
chicken(427169) microtubule associated serine/threonine kinase family member 4
domestic cat(101087553) microtubule associated serine/threonine kinase family member 4
cow(529061) microtubule associated serine/threonine kinase family member 4
Horse(100056646) microtubule associated serine/threonine kinase family member 4
dog(612904) microtubule associated serine/threonine kinase family member 4
naked mole-rat(101705611) microtubule associated serine/threonine kinase family member 4
domestic guinea pig(100731619) microtubule associated serine/threonine kinase family member 4
sheep(101122306) microtubule associated serine/threonine kinase family member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0431 AQUA Peptide SPSPLLGHSLGNS[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175171 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175171 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175171 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198828 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198828 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198828 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_283179 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_283179 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_283179 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015183 Rosetta Predictions human pricing
NM_198828 Rosetta Predictions human pricing
XM_001063274 Rosetta Predictions rat pricing
XM_226732 Rosetta Predictions rat pricing
XM_283179 Rosetta Predictions mouse pricing
XM_896987 Rosetta Predictions mouse pricing
XM_896995 Rosetta Predictions mouse pricing
XM_897003 Rosetta Predictions mouse pricing
XM_897011 Rosetta Predictions mouse pricing
XM_915307 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015183 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347217 predicted 2128
2 SASI_Hs02_00347218 predicted 900
3 SASI_Hs02_00347219 predicted 1247
4 SASI_Hs02_00347220 predicted 864
5 SASI_Hs02_00347221 predicted 2358
6 SASI_Hs02_00347222 predicted 1697
7 SASI_Hs02_00347223 predicted 6217
8 SASI_Hs02_00347224 predicted 2239
9 SASI_Hs02_00347225 predicted 3057
10 SASI_Hs02_00347226 predicted 1011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198828 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061100 predicted 1050
2 SASI_Hs01_00061101 predicted 818
3 SASI_Hs01_00061102 predicted 1053
4 SASI_Hs01_00061103 predicted 821
5 SASI_Hs01_00061104 predicted 687
6 SASI_Hs01_00061105 predicted 1050
7 SASI_Hs01_00061106 predicted 439
8 SASI_Hs01_00061107 predicted 874
9 SASI_Hs01_00061108 predicted 944
10 SASI_Hs01_00061109 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063274 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00306462 predicted 4215
2 SASI_Rn02_00306463 predicted 2994
3 SASI_Rn02_00306464 predicted 2006
4 SASI_Rn02_00306465 predicted 6174
5 SASI_Rn02_00306466 predicted 1229
6 SASI_Rn02_00306467 predicted 1672
7 SASI_Rn02_00306468 predicted 6660
8 SASI_Rn02_00306469 predicted 4023
9 SASI_Rn02_00306470 predicted 7556
10 SASI_Rn02_00306471 predicted 2344
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226732 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383835 predicted 4212
2 SASI_Rn02_00383836 predicted 3003
3 SASI_Rn02_00383837 predicted 2011
4 SASI_Rn02_00383838 predicted 6167
5 SASI_Rn02_00383839 predicted 1231
6 SASI_Rn02_00383840 predicted 1671
7 SASI_Rn02_00383841 predicted 6663
8 SASI_Rn02_00383842 predicted 4022
9 SASI_Rn02_00383843 predicted 7555
10 SASI_Rn02_00383844 predicted 2347
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283179 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259339 predicted 7059
2 SASI_Mm01_00259340 predicted 7100
3 SASI_Mm01_00259341 predicted 2007
4 SASI_Mm01_00259343 predicted 1796
5 SASI_Mm01_00259344 predicted 3554
6 SASI_Mm01_00259345 predicted 2575
7 SASI_Mm01_00259346 predicted 2310
8 SASI_Mm01_00259347 predicted 4043
9 SASI_Mm01_00259348 predicted 3000
10 SASI_Mm02_00425610 predicted 1440
11 SASI_Mm01_00259342 predicted 7841
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896987 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255703 predicted 1837
2 SASI_Mm01_00255704 predicted 1665
3 SASI_Mm01_00255705 predicted 1645
4 SASI_Mm01_00255706 predicted 2037
5 SASI_Mm01_00255707 predicted 1900
6 SASI_Mm01_00255708 predicted 1637
7 SASI_Mm01_00255709 predicted 1885
8 SASI_Mm01_00255710 predicted 2010
9 SASI_Mm01_00255711 predicted 1368
10 SASI_Mm01_00255712 predicted 2058
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896995 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00269130 predicted 1987
2 SASI_Mm01_00269131 predicted 1264
3 SASI_Mm01_00269132 predicted 1930
4 SASI_Mm01_00269133 predicted 1998
5 SASI_Mm01_00269134 predicted 1923
6 SASI_Mm01_00269135 predicted 2058
7 SASI_Mm01_00269136 predicted 1482
8 SASI_Mm01_00269137 predicted 1615
9 SASI_Mm01_00269138 predicted 1535
10 SASI_Mm01_00269139 predicted 2047
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897003 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266372 predicted 1628
2 SASI_Mm01_00266373 predicted 1394
3 SASI_Mm01_00266374 predicted 1480
4 SASI_Mm01_00266375 predicted 1524
5 SASI_Mm01_00266376 predicted 1536
6 SASI_Mm01_00266377 predicted 1536
7 SASI_Mm01_00266378 predicted 1505
8 SASI_Mm01_00266379 predicted 1582
9 SASI_Mm01_00266380 predicted 1413
10 SASI_Mm01_00266381 predicted 1423
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897011 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255957 predicted 2162
2 SASI_Mm01_00255958 predicted 1595
3 SASI_Mm01_00255959 predicted 1670
4 SASI_Mm01_00255960 predicted 1584
5 SASI_Mm01_00255961 predicted 1268
6 SASI_Mm01_00255962 predicted 1892
7 SASI_Mm01_00255963 predicted 1859
8 SASI_Mm01_00255964 predicted 1730
9 SASI_Mm01_00255965 predicted 1476
10 SASI_Mm01_00255966 predicted 1999
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_915307 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00439344 predicted 7069
2 SASI_Mm02_00439345 predicted 7105
3 SASI_Mm02_00439346 predicted 1791
4 SASI_Mm02_00439347 predicted 3547
5 SASI_Mm02_00439348 predicted 2581
6 SASI_Mm02_00439349 predicted 2316
7 SASI_Mm02_00439350 predicted 4037
8 SASI_Mm02_00439351 predicted 3002
9 SASI_Mm02_00439352 predicted 4197
10 SASI_Mm02_00439353 predicted 1437
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175171
MAST4 MISSION shRNA Bacterial Glycerol Stock
microtubule associated serine/threonine kinase family member 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000360967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175171.3-1828s21c1
Sequence:CCGGACTGACATCCCTAGGTATATCCTCGAGGATATACCTAGGGATGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175171.3-8527s21c1
Sequence:CCGGACGTAACCATAACGTAGTAAGCTCGAGCTTACTACGTTATGGTTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175171.3-4233s21c1
Sequence:CCGGTTATCGTTCTACTCCCGATTTCTCGAGAAATCGGGAGTAGAACGATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175171.3-5330s21c1
Sequence:CCGGACAGCAAGCTGGCCAATATTGCTCGAGCAATATTGGCCAGCTTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175171
MAST4 MISSION shRNA shRNA Plasmid DNA
microtubule associated serine/threonine kinase family member 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000360967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175171.3-1828s21c1
Sequence:CCGGACTGACATCCCTAGGTATATCCTCGAGGATATACCTAGGGATGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175171.3-8527s21c1
Sequence:CCGGACGTAACCATAACGTAGTAAGCTCGAGCTTACTACGTTATGGTTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175171.3-4233s21c1
Sequence:CCGGTTATCGTTCTACTCCCGATTTCTCGAGAAATCGGGAGTAGAACGATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175171.3-5330s21c1
Sequence:CCGGACAGCAAGCTGGCCAATATTGCTCGAGCAATATTGGCCAGCTTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175171
MAST4 MISSION shRNA Lentiviral Transduction Particles
microtubule associated serine/threonine kinase family member 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000360967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175171.3-1828s21c1
Sequence:CCGGACTGACATCCCTAGGTATATCCTCGAGGATATACCTAGGGATGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175171.3-8527s21c1
Sequence:CCGGACGTAACCATAACGTAGTAAGCTCGAGCTTACTACGTTATGGTTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175171.3-4233s21c1
Sequence:CCGGTTATCGTTCTACTCCCGATTTCTCGAGAAATCGGGAGTAGAACGATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175171.3-5330s21c1
Sequence:CCGGACAGCAAGCTGGCCAATATTGCTCGAGCAATATTGGCCAGCTTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198828
MAST4 MISSION shRNA Bacterial Glycerol Stock
microtubule associated serine/threonine kinase family member 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198828.1-633s1c1
Sequence:CCGGCGAGGAGCTTGACCACATATTCTCGAGAATATGTGGTCAAGCTCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198828.1-664s1c1
Sequence:CCGGCCCATGCCGTTTCGGAAATGCCTCGAGGCATTTCCGAAACGGCATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198828.1-342s1c1
Sequence:CCGGGACTCCAGCCTCTGCGCTGGTCTCGAGACCAGCGCAGAGGCTGGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198828.1-734s1c1
Sequence:CCGGGACAGCTGAGTGAGGATGGAACTCGAGTTCCATCCTCACTCAGCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198828.1-634s1c1
Sequence:CCGGGAGGAGCTTGACCACATATTACTCGAGTAATATGTGGTCAAGCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198828.1-944s1c1
Sequence:CCGGGAAGTTTGATAGATTCCCAGACTCGAGTCTGGGAATCTATCAAACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198828.1-938s1c1
Sequence:CCGGGAAGAGGAAGTTTGATAGATTCTCGAGAATCTATCAAACTTCCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198828
MAST4 MISSION shRNA shRNA Plasmid DNA
microtubule associated serine/threonine kinase family member 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198828.1-633s1c1
Sequence:CCGGCGAGGAGCTTGACCACATATTCTCGAGAATATGTGGTCAAGCTCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198828.1-664s1c1
Sequence:CCGGCCCATGCCGTTTCGGAAATGCCTCGAGGCATTTCCGAAACGGCATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198828.1-342s1c1
Sequence:CCGGGACTCCAGCCTCTGCGCTGGTCTCGAGACCAGCGCAGAGGCTGGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198828.1-734s1c1
Sequence:CCGGGACAGCTGAGTGAGGATGGAACTCGAGTTCCATCCTCACTCAGCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198828.1-634s1c1
Sequence:CCGGGAGGAGCTTGACCACATATTACTCGAGTAATATGTGGTCAAGCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198828.1-944s1c1
Sequence:CCGGGAAGTTTGATAGATTCCCAGACTCGAGTCTGGGAATCTATCAAACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198828.1-938s1c1
Sequence:CCGGGAAGAGGAAGTTTGATAGATTCTCGAGAATCTATCAAACTTCCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198828
MAST4 MISSION shRNA Lentiviral Transduction Particles
microtubule associated serine/threonine kinase family member 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198828.1-633s1c1
Sequence:CCGGCGAGGAGCTTGACCACATATTCTCGAGAATATGTGGTCAAGCTCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198828.1-664s1c1
Sequence:CCGGCCCATGCCGTTTCGGAAATGCCTCGAGGCATTTCCGAAACGGCATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198828.1-342s1c1
Sequence:CCGGGACTCCAGCCTCTGCGCTGGTCTCGAGACCAGCGCAGAGGCTGGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198828.1-734s1c1
Sequence:CCGGGACAGCTGAGTGAGGATGGAACTCGAGTTCCATCCTCACTCAGCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198828.1-634s1c1
Sequence:CCGGGAGGAGCTTGACCACATATTACTCGAGTAATATGTGGTCAAGCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198828.1-944s1c1
Sequence:CCGGGAAGTTTGATAGATTCCCAGACTCGAGTCTGGGAATCTATCAAACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198828.1-938s1c1
Sequence:CCGGGAAGAGGAAGTTTGATAGATTCTCGAGAATCTATCAAACTTCCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_283179
MAST4 MISSION shRNA Bacterial Glycerol Stock
microtubule associated serine/threonine kinase family member 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000022932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283179.2-2257s1c1
Sequence:CCGGCCCAGTTGATATGGCCAGAATCTCGAGATTCTGGCCATATCAACTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283179.2-3469s1c1
Sequence:CCGGGCGCTTAGAAAGCACAGAGAACTCGAGTTCTCTGTGCTTTCTAAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283179.2-1699s1c1
Sequence:CCGGCGCTCGGTTATTGGAGTGTTTCTCGAGAAACACTCCAATAACCGAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283179.2-4105s1c1
Sequence:CCGGCCGAAGTTTCTCCTGCTTAAACTCGAGTTTAAGCAGGAGAAACTTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_283179
MAST4 MISSION shRNA shRNA Plasmid DNA
microtubule associated serine/threonine kinase family member 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000022932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283179.2-2257s1c1
Sequence:CCGGCCCAGTTGATATGGCCAGAATCTCGAGATTCTGGCCATATCAACTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283179.2-3469s1c1
Sequence:CCGGGCGCTTAGAAAGCACAGAGAACTCGAGTTCTCTGTGCTTTCTAAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283179.2-1699s1c1
Sequence:CCGGCGCTCGGTTATTGGAGTGTTTCTCGAGAAACACTCCAATAACCGAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283179.2-4105s1c1
Sequence:CCGGCCGAAGTTTCTCCTGCTTAAACTCGAGTTTAAGCAGGAGAAACTTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_283179
MAST4 MISSION shRNA Lentiviral Transduction Particles
microtubule associated serine/threonine kinase family member 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000022932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283179.2-2257s1c1
Sequence:CCGGCCCAGTTGATATGGCCAGAATCTCGAGATTCTGGCCATATCAACTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283179.2-3469s1c1
Sequence:CCGGGCGCTTAGAAAGCACAGAGAACTCGAGTTCTCTGTGCTTTCTAAGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283179.2-1699s1c1
Sequence:CCGGCGCTCGGTTATTGGAGTGTTTCTCGAGAAACACTCCAATAACCGAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283179.2-4105s1c1
Sequence:CCGGCCGAAGTTTCTCCTGCTTAAACTCGAGTTTAAGCAGGAGAAACTTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)