EMAIL THIS PAGE TO A FRIEND

MASTL

microtubule associated serine/threonine kinase-like

80 Gene Product Result for
Synonyms: GREATWALL GW GWL MAST-L RP11-85G18.2 THC2 hGWL
UniProtKB ID: Q96GX5, Q5T8D5, Q5T8D7, Q8NCD6, Q96SJ5
Gene ID:
Human(84930) Summary: This gene encodes a microtubule-associated serine/threonine kinase. Mutations at this locus have been associated with autosomal dominant thrombocytopenia, also known as thrombocytopenia-2. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Feb 2010]
Mouse(67121) microtubule associated serine/threonine kinase-like
Rat(307169) microtubule associated serine/threonine kinase-like
Zebrafish(445215) microtubule associated serine/threonine kinase-like
cow(540206) microtubule associated serine/threonine kinase-like
Horse(100055294) microtubule associated serine/threonine kinase-like
domestic cat(101083601) microtubule associated serine/threonine kinase-like
dog(607216) microtubule associated serine/threonine kinase-like
chicken(420487) microtubule associated serine/threonine kinase-like
sheep(101119067) microtubule associated serine/threonine kinase-like
domestic guinea pig(100727887) microtubule associated serine/threonine kinase-like
naked mole-rat(101723064) microtubule associated serine/threonine kinase-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032844 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032844 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032844 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025979 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025979 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025979 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032844 siRNAs that have been validated in the lab human pricing
NM_001107369 Rosetta Predictions rat pricing
NM_025979 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032844 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086370 validated 3253
2 SASI_Hs01_00086371 predicted 1686
3 SASI_Hs01_00086372 predicted 1882
4 SASI_Hs01_00086373 predicted 2859
5 SASI_Hs01_00086375 predicted 2201
6 SASI_Hs01_00086376 predicted 2451
7 SASI_Hs01_00086377 predicted 2156
8 SASI_Hs01_00086378 predicted 3330
9 SASI_Hs01_00086379 predicted 1140
10 SASI_Hs02_00360440 predicted 990
11 SASI_Hs01_00086374 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107369 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228145 predicted 2712
2 SASI_Rn02_00228146 predicted 1667
3 SASI_Rn02_00228147 predicted 411
4 SASI_Rn02_00228148 predicted 1113
5 SASI_Rn02_00228149 predicted 796
6 SASI_Rn02_00228150 predicted 2631
7 SASI_Rn02_00228151 predicted 584
8 SASI_Rn02_00228152 predicted 467
9 SASI_Rn02_00228153 predicted 506
10 SASI_Rn02_00228154 predicted 1623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025979 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138770 predicted 2037
2 SASI_Mm01_00138771 predicted 371
3 SASI_Mm02_00329410 predicted 784
4 SASI_Mm01_00138772 predicted 2065
5 SASI_Mm01_00138773 predicted 542
6 SASI_Mm01_00138774 predicted 220
7 SASI_Mm01_00138775 predicted 794
8 SASI_Mm01_00138776 predicted 2308
9 SASI_Mm01_00138777 predicted 2139
10 SASI_Mm02_00329411 predicted 2700
11 SASI_Mm01_00138778 predicted 476
12 SASI_Mm01_00138779 predicted 736
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032844
VALIDATED
MASTL MISSION shRNA Bacterial Glycerol Stock
microtubule associated serine/threonine kinase-like
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032844.3-954s21c1
Sequence:CCGGTGTCAAGTCTCTCCTACATATCTCGAGATATGTAGGAGAGACTTGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032844.3-2002s21c1
Sequence:CCGGGAGTATAAGCATAACGAAATGCTCGAGCATTTCGTTATGCTTATACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032844.3-3009s21c1
Sequence:CCGGGTTATCTGATAATGCTCAAAGCTCGAGCTTTGAGCATTATCAGATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032844.3-777s21c1
Sequence:CCGGGTATGCAGTAAAGGTTGTTAACTCGAGTTAACAACCTTTACTGCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032844.3-1355s21c1
Sequence:CCGGGCCCTATGTCTGTAGATCAAACTCGAGTTTGATCTACAGACATAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032844.x-1818s1c1
Sequence:CCGGGTCAGCCCTTAGATTCAGATACTCGAGTATCTGAATCTAAGGGCTGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032844.x-1212s1c1
Sequence:CCGGGCTCTTGTGTAAACCTTGCTACTCGAGTAGCAAGGTTTACACAAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032844.x-2408s1c1
Sequence:CCGGCCACAACAAGTATTCCAGAATCTCGAGATTCTGGAATACTTGTTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032844.x-2725s1c1
Sequence:CCGGAGCCTCGTGTTATAGAATGAACTCGAGTTCATTCTATAACACGAGGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032844.x-334s1c1
Sequence:CCGGCCCATTCATTGTCCATTTGTACTCGAGTACAAATGGACAATGAATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032844.1-911s1c1
Sequence:CCGGGTGAAGTGTCTAACTTCTAATCTCGAGATTAGAAGTTAGACACTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032844.1-2117s1c1
Sequence:CCGGCGTGCCTACAGTGGTTCATATCTCGAGATATGAACCACTGTAGGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194962    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032844.1-2859s1c1
Sequence:CCGGCTGAAAGGAATATAGTCAGTACTCGAGTACTGACTATATTCCTTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032844
VALIDATED
MASTL MISSION shRNA shRNA Plasmid DNA
microtubule associated serine/threonine kinase-like
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032844.3-954s21c1
Sequence:CCGGTGTCAAGTCTCTCCTACATATCTCGAGATATGTAGGAGAGACTTGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032844.3-2002s21c1
Sequence:CCGGGAGTATAAGCATAACGAAATGCTCGAGCATTTCGTTATGCTTATACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032844.3-3009s21c1
Sequence:CCGGGTTATCTGATAATGCTCAAAGCTCGAGCTTTGAGCATTATCAGATAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032844.3-777s21c1
Sequence:CCGGGTATGCAGTAAAGGTTGTTAACTCGAGTTAACAACCTTTACTGCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032844.3-1355s21c1
Sequence:CCGGGCCCTATGTCTGTAGATCAAACTCGAGTTTGATCTACAGACATAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032844.x-1818s1c1
Sequence:CCGGGTCAGCCCTTAGATTCAGATACTCGAGTATCTGAATCTAAGGGCTGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032844.x-1212s1c1
Sequence:CCGGGCTCTTGTGTAAACCTTGCTACTCGAGTAGCAAGGTTTACACAAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032844.x-2408s1c1
Sequence:CCGGCCACAACAAGTATTCCAGAATCTCGAGATTCTGGAATACTTGTTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032844.x-2725s1c1
Sequence:CCGGAGCCTCGTGTTATAGAATGAACTCGAGTTCATTCTATAACACGAGGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032844.x-334s1c1
Sequence:CCGGCCCATTCATTGTCCATTTGTACTCGAGTACAAATGGACAATGAATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032844.1-911s1c1
Sequence:CCGGGTGAAGTGTCTAACTTCTAATCTCGAGATTAGAAGTTAGACACTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032844.1-2117s1c1
Sequence:CCGGCGTGCCTACAGTGGTTCATATCTCGAGATATGAACCACTGTAGGCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194962    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032844.1-2859s1c1
Sequence:CCGGCTGAAAGGAATATAGTCAGTACTCGAGTACTGACTATATTCCTTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032844
VALIDATED
MASTL MISSION shRNA Lentiviral Transduction Particles
microtubule associated serine/threonine kinase-like
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032844.3-954s21c1
Sequence:CCGGTGTCAAGTCTCTCCTACATATCTCGAGATATGTAGGAGAGACTTGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032844.3-2002s21c1
Sequence:CCGGGAGTATAAGCATAACGAAATGCTCGAGCATTTCGTTATGCTTATACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032844.3-3009s21c1
Sequence:CCGGGTTATCTGATAATGCTCAAAGCTCGAGCTTTGAGCATTATCAGATAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032844.3-777s21c1
Sequence:CCGGGTATGCAGTAAAGGTTGTTAACTCGAGTTAACAACCTTTACTGCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032844.3-1355s21c1
Sequence:CCGGGCCCTATGTCTGTAGATCAAACTCGAGTTTGATCTACAGACATAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032844.x-1818s1c1
Sequence:CCGGGTCAGCCCTTAGATTCAGATACTCGAGTATCTGAATCTAAGGGCTGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032844.x-1212s1c1
Sequence:CCGGGCTCTTGTGTAAACCTTGCTACTCGAGTAGCAAGGTTTACACAAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032844.x-2408s1c1
Sequence:CCGGCCACAACAAGTATTCCAGAATCTCGAGATTCTGGAATACTTGTTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032844.x-2725s1c1
Sequence:CCGGAGCCTCGTGTTATAGAATGAACTCGAGTTCATTCTATAACACGAGGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032844.x-334s1c1
Sequence:CCGGCCCATTCATTGTCCATTTGTACTCGAGTACAAATGGACAATGAATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032844.1-911s1c1
Sequence:CCGGGTGAAGTGTCTAACTTCTAATCTCGAGATTAGAAGTTAGACACTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032844.1-2117s1c1
Sequence:CCGGCGTGCCTACAGTGGTTCATATCTCGAGATATGAACCACTGTAGGCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194962    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032844.1-2859s1c1
Sequence:CCGGCTGAAAGGAATATAGTCAGTACTCGAGTACTGACTATATTCCTTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025979
MASTL MISSION shRNA Bacterial Glycerol Stock
microtubule associated serine/threonine kinase-like
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025979.4-511s21c1
Sequence:CCGGTGTCAAGTCTCTCCTACATATCTCGAGATATGTAGGAGAGACTTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025979.4-544s21c1
Sequence:CCGGTGATGAAGAGATGGCTATAAACTCGAGTTTATAGCCATCTCTTCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025979.4-481s21c1
Sequence:CCGGCTTGATAATGGAGTATCTTATCTCGAGATAAGATACTCCATTATCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025979.2-2609s1c1
Sequence:CCGGGCCAGAAATAATGCTCAACATCTCGAGATGTTGAGCATTATTTCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025979.2-1594s1c1
Sequence:CCGGGCATATACCAACGATAGCAAACTCGAGTTTGCTATCGTTGGTATATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025979.2-963s1c1
Sequence:CCGGGCCAGTCACATACCTTCGTATCTCGAGATACGAAGGTATGTGACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025979.2-2070s1c1
Sequence:CCGGCCTGTGATTACAGTGGTTCATCTCGAGATGAACCACTGTAATCACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025979
MASTL MISSION shRNA shRNA Plasmid DNA
microtubule associated serine/threonine kinase-like
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025979.4-511s21c1
Sequence:CCGGTGTCAAGTCTCTCCTACATATCTCGAGATATGTAGGAGAGACTTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025979.4-544s21c1
Sequence:CCGGTGATGAAGAGATGGCTATAAACTCGAGTTTATAGCCATCTCTTCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025979.4-481s21c1
Sequence:CCGGCTTGATAATGGAGTATCTTATCTCGAGATAAGATACTCCATTATCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025979.2-2609s1c1
Sequence:CCGGGCCAGAAATAATGCTCAACATCTCGAGATGTTGAGCATTATTTCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025979.2-1594s1c1
Sequence:CCGGGCATATACCAACGATAGCAAACTCGAGTTTGCTATCGTTGGTATATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025979.2-963s1c1
Sequence:CCGGGCCAGTCACATACCTTCGTATCTCGAGATACGAAGGTATGTGACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025979.2-2070s1c1
Sequence:CCGGCCTGTGATTACAGTGGTTCATCTCGAGATGAACCACTGTAATCACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025979
MASTL MISSION shRNA Lentiviral Transduction Particles
microtubule associated serine/threonine kinase-like
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025979.4-511s21c1
Sequence:CCGGTGTCAAGTCTCTCCTACATATCTCGAGATATGTAGGAGAGACTTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025979.4-544s21c1
Sequence:CCGGTGATGAAGAGATGGCTATAAACTCGAGTTTATAGCCATCTCTTCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025979.4-481s21c1
Sequence:CCGGCTTGATAATGGAGTATCTTATCTCGAGATAAGATACTCCATTATCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025979.2-2609s1c1
Sequence:CCGGGCCAGAAATAATGCTCAACATCTCGAGATGTTGAGCATTATTTCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025979.2-1594s1c1
Sequence:CCGGGCATATACCAACGATAGCAAACTCGAGTTTGCTATCGTTGGTATATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025979.2-963s1c1
Sequence:CCGGGCCAGTCACATACCTTCGTATCTCGAGATACGAAGGTATGTGACTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025979.2-2070s1c1
Sequence:CCGGCCTGTGATTACAGTGGTTCATCTCGAGATGAACCACTGTAATCACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)