EMAIL THIS PAGE TO A FRIEND

MAT1A

methionine adenosyltransferase I, alpha

71 Gene Product Result for
Synonyms: MAT MATA1 SAMS SAMS1
UniProtKB ID: Q00266, D3DWD5, Q5QP09
Gene ID:
Human(4143) Summary: This gene catalyzes a two-step reaction that involves the transfer of the adenosyl moiety of ATP to methionine to form S-adenosylmethionine and tripolyphosphate, which is subsequently cleaved to PPi and Pi. S-adenosylmethionine is the source of methyl groups for most biological methylations. The encoded protein is found as a homotetramer (MAT I) or a homodimer (MAT III) whereas a third form, MAT II (gamma), is encoded by the MAT2A gene. Mutations in this gene are associated with methionine adenosyltransferase deficiency. [provided by RefSeq, Jul 2008]
Mouse(11720) methionine adenosyltransferase I, alpha
Rat(25331) methionine adenosyltransferase I, alpha
Zebrafish(334195) methionine adenosyltransferase I, alpha
domestic cat(101101506) methionine adenosyltransferase I, alpha
cow(541078) methionine adenosyltransferase I, alpha
chicken(423628) methionine adenosyltransferase I, alpha
dog(608788) methionine adenosyltransferase I, alpha
sheep(101107762) methionine adenosyltransferase I, alpha
naked mole-rat(101714973) methionine adenosyltransferase I, alpha
domestic guinea pig(100728681) methionine adenosyltransferase I, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108543 Anti-MAT1A IgG fraction of antiserum dog, human, bovine
western blot pricing
AV41398 Anti-MAT1A (AB1) antibody produced in rabbit IgG fraction of antiserum guinea pig, rat, horse, dog, human, mouse, rabbit, bovine
immunohistochemistry, western blot pricing
AV41399 Anti-MAT1A (AB2) antibody produced in rabbit IgG fraction of antiserum rat, canine, human, guinea pig, zebrafish, mouse, horse, pig, rabbit, bovine
western blot pricing
HPA048627 Anti-MAT1A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1402264 Monoclonal Anti-MAT1A antibody produced in mouse clone 4D11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP), western blot pricing
SAB5300254 Monoclonal Anti-MATN1 antibody produced in mouse clone 5A8, ascites fluid human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133653 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133653 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133653 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000429 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000429 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000429 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000429 Rosetta Predictions human pricing
NM_012860 Rosetta Predictions rat pricing
XM_579352 Rosetta Predictions rat pricing
NM_133653 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117948 predicted 1041
2 SASI_Hs01_00117949 predicted 1682
3 SASI_Hs01_00117950 predicted 1113
4 SASI_Hs01_00117951 predicted 649
5 SASI_Hs01_00117952 predicted 1620
6 SASI_Hs01_00117953 predicted 1027
7 SASI_Hs01_00117954 predicted 830
8 SASI_Hs02_00302538 predicted 1196
9 SASI_Hs01_00117956 predicted 790
10 SASI_Hs01_00117957 predicted 850
11 SASI_Hs01_00117955 predicted 1287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012860 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096493 predicted 1362
2 SASI_Rn01_00096495 predicted 1239
3 SASI_Rn01_00096496 predicted 507
4 SASI_Rn01_00096497 predicted 513
5 SASI_Rn01_00096498 predicted 714
6 SASI_Rn01_00096499 predicted 801
7 SASI_Rn01_00096500 predicted 371
8 SASI_Rn01_00096501 predicted 697
9 SASI_Rn01_00096502 predicted 694
10 SASI_Rn02_00260346 predicted 1372
11 SASI_Rn01_00096494 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579352 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00135387 predicted 1116
2 SASI_Rn01_00135388 predicted 1228
3 SASI_Rn01_00135389 predicted 888
4 SASI_Rn01_00135390 predicted 703
5 SASI_Rn01_00135391 predicted 689
6 SASI_Rn01_00135392 predicted 1335
7 SASI_Rn01_00135393 predicted 949
8 SASI_Rn01_00135394 predicted 1036
9 SASI_Rn01_00135395 predicted 894
10 SASI_Rn01_00135396 predicted 1392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133653 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338586 predicted 821
2 SASI_Mm01_00155303 predicted 601
3 SASI_Mm01_00155304 predicted 472
4 SASI_Mm01_00155305 predicted 768
5 SASI_Mm01_00155306 predicted 461
6 SASI_Mm01_00155307 predicted 561
7 SASI_Mm01_00155308 predicted 1492
8 SASI_Mm01_00155309 predicted 613
9 SASI_Mm01_00155310 predicted 1284
10 SASI_Mm01_00155311 predicted 749
11 SASI_Mm01_00155312 predicted 643
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133653
MAT1A MISSION shRNA Bacterial Glycerol Stock
methionine adenosyltransferase I, alpha
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133653.2-1349s21c1
Sequence:CCGGATTTCGGGAGAAGCGAGTTTCCTCGAGGAAACTCGCTTCTCCCGAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133653.2-1541s21c1
Sequence:CCGGGCAATCTGCAAACATCTTATGCTCGAGCATAAGATGTTTGCAGATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133653.1-780s1c1
Sequence:CCGGGCAGGATAATGGTGCAGTCATCTCGAGATGACTGCACCATTATCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133653.1-262s1c1
Sequence:CCGGGCCTTCATGTTCACATCAGAACTCGAGTTCTGATGTGAACATGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133653.1-1708s1c1
Sequence:CCGGCCTCCCATAGTCTGAACCTTACTCGAGTAAGGTTCAGACTATGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133653.1-1004s1c1
Sequence:CCGGGCAAGATTATTGTGGACACATCTCGAGATGTGTCCACAATAATCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133653.1-637s1c1
Sequence:CCGGGCTACTGATGAGACCGAGGAACTCGAGTTCCTCGGTCTCATCAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133653
MAT1A MISSION shRNA shRNA Plasmid DNA
methionine adenosyltransferase I, alpha
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133653.2-1349s21c1
Sequence:CCGGATTTCGGGAGAAGCGAGTTTCCTCGAGGAAACTCGCTTCTCCCGAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133653.2-1541s21c1
Sequence:CCGGGCAATCTGCAAACATCTTATGCTCGAGCATAAGATGTTTGCAGATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133653.1-780s1c1
Sequence:CCGGGCAGGATAATGGTGCAGTCATCTCGAGATGACTGCACCATTATCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133653.1-262s1c1
Sequence:CCGGGCCTTCATGTTCACATCAGAACTCGAGTTCTGATGTGAACATGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133653.1-1708s1c1
Sequence:CCGGCCTCCCATAGTCTGAACCTTACTCGAGTAAGGTTCAGACTATGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133653.1-1004s1c1
Sequence:CCGGGCAAGATTATTGTGGACACATCTCGAGATGTGTCCACAATAATCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133653.1-637s1c1
Sequence:CCGGGCTACTGATGAGACCGAGGAACTCGAGTTCCTCGGTCTCATCAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133653
MAT1A MISSION shRNA Lentiviral Transduction Particles
methionine adenosyltransferase I, alpha
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133653.2-1349s21c1
Sequence:CCGGATTTCGGGAGAAGCGAGTTTCCTCGAGGAAACTCGCTTCTCCCGAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133653.2-1541s21c1
Sequence:CCGGGCAATCTGCAAACATCTTATGCTCGAGCATAAGATGTTTGCAGATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133653.1-780s1c1
Sequence:CCGGGCAGGATAATGGTGCAGTCATCTCGAGATGACTGCACCATTATCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133653.1-262s1c1
Sequence:CCGGGCCTTCATGTTCACATCAGAACTCGAGTTCTGATGTGAACATGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133653.1-1708s1c1
Sequence:CCGGCCTCCCATAGTCTGAACCTTACTCGAGTAAGGTTCAGACTATGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133653.1-1004s1c1
Sequence:CCGGGCAAGATTATTGTGGACACATCTCGAGATGTGTCCACAATAATCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133653.1-637s1c1
Sequence:CCGGGCTACTGATGAGACCGAGGAACTCGAGTTCCTCGGTCTCATCAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000429
MAT1A MISSION shRNA Bacterial Glycerol Stock
methionine adenosyltransferase I, alpha
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000429.2-613s21c1
Sequence:CCGGTGCGTCCATCTGGACAGAAATCTCGAGATTTCTGTCCAGATGGACGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424891    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000429.2-1628s21c1
Sequence:CCGGGAGGTTGGATCTTGATGTAAGCTCGAGCTTACATCAAGATCCAACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000429.2-1034s21c1
Sequence:CCGGGTGTCACTGGCCGTAAGATTACTCGAGTAATCTTACGGCCAGTGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000429.1-474s1c1
Sequence:CCGGCAGGGTTTGATGTTCGGCTATCTCGAGATAGCCGAACATCAAACCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000429.1-272s1c1
Sequence:CCGGGTGTGGTGAGATCACCTCAATCTCGAGATTGAGGTGATCTCACCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000429.1-1017s1c1
Sequence:CCGGGTCCAGGTTTCCTATGCCATTCTCGAGAATGGCATAGGAAACCTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000429.1-1205s1c1
Sequence:CCGGCCATTTCGGAAGAAGCGAGTTCTCGAGAACTCGCTTCTTCCGAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000429.1-614s1c1
Sequence:CCGGGACTCAGGTGACAGTTCAGTACTCGAGTACTGAACTGTCACCTGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000429
MAT1A MISSION shRNA shRNA Plasmid DNA
methionine adenosyltransferase I, alpha
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000429.2-613s21c1
Sequence:CCGGTGCGTCCATCTGGACAGAAATCTCGAGATTTCTGTCCAGATGGACGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424891    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000429.2-1628s21c1
Sequence:CCGGGAGGTTGGATCTTGATGTAAGCTCGAGCTTACATCAAGATCCAACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000429.2-1034s21c1
Sequence:CCGGGTGTCACTGGCCGTAAGATTACTCGAGTAATCTTACGGCCAGTGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000429.1-474s1c1
Sequence:CCGGCAGGGTTTGATGTTCGGCTATCTCGAGATAGCCGAACATCAAACCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000429.1-272s1c1
Sequence:CCGGGTGTGGTGAGATCACCTCAATCTCGAGATTGAGGTGATCTCACCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000429.1-1017s1c1
Sequence:CCGGGTCCAGGTTTCCTATGCCATTCTCGAGAATGGCATAGGAAACCTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000429.1-1205s1c1
Sequence:CCGGCCATTTCGGAAGAAGCGAGTTCTCGAGAACTCGCTTCTTCCGAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000429.1-614s1c1
Sequence:CCGGGACTCAGGTGACAGTTCAGTACTCGAGTACTGAACTGTCACCTGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000429
MAT1A MISSION shRNA Lentiviral Transduction Particles
methionine adenosyltransferase I, alpha
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000429.2-613s21c1
Sequence:CCGGTGCGTCCATCTGGACAGAAATCTCGAGATTTCTGTCCAGATGGACGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424891    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000429.2-1628s21c1
Sequence:CCGGGAGGTTGGATCTTGATGTAAGCTCGAGCTTACATCAAGATCCAACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000429.2-1034s21c1
Sequence:CCGGGTGTCACTGGCCGTAAGATTACTCGAGTAATCTTACGGCCAGTGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000429.1-474s1c1
Sequence:CCGGCAGGGTTTGATGTTCGGCTATCTCGAGATAGCCGAACATCAAACCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000429.1-272s1c1
Sequence:CCGGGTGTGGTGAGATCACCTCAATCTCGAGATTGAGGTGATCTCACCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000429.1-1017s1c1
Sequence:CCGGGTCCAGGTTTCCTATGCCATTCTCGAGAATGGCATAGGAAACCTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000429.1-1205s1c1
Sequence:CCGGCCATTTCGGAAGAAGCGAGTTCTCGAGAACTCGCTTCTTCCGAAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000429.1-614s1c1
Sequence:CCGGGACTCAGGTGACAGTTCAGTACTCGAGTACTGAACTGTCACCTGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)