EMAIL THIS PAGE TO A FRIEND

MAT2B

methionine adenosyltransferase II, beta

158 Gene Product Result for
Synonyms: MAT-II MATIIbeta Nbla02999 SDR23E1 TGR
Gene ID:
Human(27430) Summary: The protein encoded by this gene belongs to the methionine adenosyltransferase (MAT) family. MAT catalyzes the biosynthesis of S-adenosylmethionine from methionine and ATP. This protein is the regulatory beta subunit of MAT. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2012]
Mouse(108645) methionine adenosyltransferase II, beta
Rat(683630) methionine adenosyltransferase II, beta
Zebrafish(541347) methionine adenosyltransferase II, beta
dog(479301) methionine adenosyltransferase II, beta
domestic cat(101086784) methionine adenosyltransferase II, beta
chicken(416165) methionine adenosyltransferase II, beta
cow(614177) methionine adenosyltransferase II, beta
sheep(101119985) methionine adenosyltransferase II, beta
Domestic Rabbit(100358077) methionine adenosyltransferase II, beta
naked mole-rat(101724236) methionine adenosyltransferase II, beta
domestic guinea pig(100733146) methionine adenosyltransferase II, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013283 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013283 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013283 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134017 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134017 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134017 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013283 Rosetta Predictions human pricing
NM_182796 Rosetta Predictions human pricing
NM_001044282 Rosetta Predictions rat pricing
NM_134017 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020691 predicted 489
2 SASI_Hs01_00020692 predicted 879
3 SASI_Hs02_00344551 predicted 388
4 SASI_Hs01_00020693 predicted 680
5 SASI_Hs01_00020694 predicted 820
6 SASI_Hs01_00020696 predicted 861
7 SASI_Hs01_00020697 predicted 501
8 SASI_Hs02_00344552 predicted 538
9 SASI_Hs01_00020698 predicted 814
10 SASI_Hs01_00020700 predicted 892
11 SASI_Hs01_00020695 predicted 866
12 SASI_Hs01_00020699 predicted 625
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182796 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230677 predicted 519
2 SASI_Hs01_00230678 predicted 901
3 SASI_Hs02_00370942 predicted 416
4 SASI_Hs01_00230679 predicted 711
5 SASI_Hs01_00230680 predicted 848
6 SASI_Hs01_00230682 predicted 884
7 SASI_Hs01_00230683 predicted 526
8 SASI_Hs02_00370943 predicted 567
9 SASI_Hs01_00230684 predicted 841
10 SASI_Hs01_00230686 predicted 921
11 SASI_Hs01_00230681 predicted 895
12 SASI_Hs01_00230685 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044282 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205494 predicted 851
2 SASI_Rn02_00205495 predicted 458
3 SASI_Rn02_00205496 predicted 841
4 SASI_Rn02_00205497 predicted 372
5 SASI_Rn02_00205498 predicted 900
6 SASI_Rn02_00205499 predicted 1004
7 SASI_Rn02_00205500 predicted 478
8 SASI_Rn02_00205501 predicted 651
9 SASI_Rn02_00205502 predicted 448
10 SASI_Rn02_00205503 predicted 1159
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134017 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195148 predicted 273
2 SASI_Mm01_00195149 predicted 451
3 SASI_Mm01_00195150 predicted 294
4 SASI_Mm01_00195152 predicted 826
5 SASI_Mm01_00195153 predicted 887
6 SASI_Mm01_00195154 predicted 844
7 SASI_Mm01_00195155 predicted 469
8 SASI_Mm01_00195156 predicted 241
9 SASI_Mm01_00195157 predicted 1158
10 SASI_Mm02_00339177 predicted 644
11 SASI_Mm01_00195151 predicted 453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013283
VALIDATED
MAT2B MISSION shRNA Bacterial Glycerol Stock
methionine adenosyltransferase II, beta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013283.3-832s1c1
Sequence:CCGGCCATCAATTAAGGGAACCTTTCTCGAGAAAGGTTCCCTTAATTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_013283.3-694s1c1
Sequence:CCGGGCTGTGACTGTTATGTTTGATCTCGAGATCAAACATAACAGTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013283.3-433s1c1
Sequence:CCGGGCCTCTCAACTTAATGTGGATCTCGAGATCCACATTAAGTTGAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_013283.3-544s1c1
Sequence:CCGGCCTTACAGAGAGGAAGACATACTCGAGTATGTCTTCCTCTCTGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_013283.3-337s1c1
Sequence:CCGGGCAGTTCATCACATCATTCATCTCGAGATGAATGATGTGATGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013283.3-926s21c1
Sequence:CCGGGCAGTCACTTAAGACCTATTACTCGAGTAATAGGTCTTAAGTGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_013283.3-337s21c1
Sequence:CCGGGCAGTTCATCACATCATTCATCTCGAGATGAATGATGTGATGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013283.3-694s21c1
Sequence:CCGGGCTGTGACTGTTATGTTTGATCTCGAGATCAAACATAACAGTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_013283.3-544s21c1
Sequence:CCGGCCTTACAGAGAGGAAGACATACTCGAGTATGTCTTCCTCTCTGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303601    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_013283.3-1219s21c1
Sequence:CCGGCTTAGGATCTTTCAGGTAAATCTCGAGATTTACCTGAAAGATCCTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013283
VALIDATED
MAT2B MISSION shRNA shRNA Plasmid DNA
methionine adenosyltransferase II, beta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013283.3-832s1c1
Sequence:CCGGCCATCAATTAAGGGAACCTTTCTCGAGAAAGGTTCCCTTAATTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_013283.3-694s1c1
Sequence:CCGGGCTGTGACTGTTATGTTTGATCTCGAGATCAAACATAACAGTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013283.3-433s1c1
Sequence:CCGGGCCTCTCAACTTAATGTGGATCTCGAGATCCACATTAAGTTGAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_013283.3-544s1c1
Sequence:CCGGCCTTACAGAGAGGAAGACATACTCGAGTATGTCTTCCTCTCTGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_013283.3-337s1c1
Sequence:CCGGGCAGTTCATCACATCATTCATCTCGAGATGAATGATGTGATGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013283.3-926s21c1
Sequence:CCGGGCAGTCACTTAAGACCTATTACTCGAGTAATAGGTCTTAAGTGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_013283.3-337s21c1
Sequence:CCGGGCAGTTCATCACATCATTCATCTCGAGATGAATGATGTGATGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013283.3-694s21c1
Sequence:CCGGGCTGTGACTGTTATGTTTGATCTCGAGATCAAACATAACAGTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_013283.3-544s21c1
Sequence:CCGGCCTTACAGAGAGGAAGACATACTCGAGTATGTCTTCCTCTCTGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303601    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_013283.3-1219s21c1
Sequence:CCGGCTTAGGATCTTTCAGGTAAATCTCGAGATTTACCTGAAAGATCCTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013283
VALIDATED
MAT2B MISSION shRNA Lentiviral Transduction Particles
methionine adenosyltransferase II, beta
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013283.3-832s1c1
Sequence:CCGGCCATCAATTAAGGGAACCTTTCTCGAGAAAGGTTCCCTTAATTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_013283.3-694s1c1
Sequence:CCGGGCTGTGACTGTTATGTTTGATCTCGAGATCAAACATAACAGTCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013283.3-433s1c1
Sequence:CCGGGCCTCTCAACTTAATGTGGATCTCGAGATCCACATTAAGTTGAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_013283.3-544s1c1
Sequence:CCGGCCTTACAGAGAGGAAGACATACTCGAGTATGTCTTCCTCTCTGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_013283.3-337s1c1
Sequence:CCGGGCAGTTCATCACATCATTCATCTCGAGATGAATGATGTGATGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013283.3-926s21c1
Sequence:CCGGGCAGTCACTTAAGACCTATTACTCGAGTAATAGGTCTTAAGTGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_013283.3-337s21c1
Sequence:CCGGGCAGTTCATCACATCATTCATCTCGAGATGAATGATGTGATGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013283.3-694s21c1
Sequence:CCGGGCTGTGACTGTTATGTTTGATCTCGAGATCAAACATAACAGTCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_013283.3-544s21c1
Sequence:CCGGCCTTACAGAGAGGAAGACATACTCGAGTATGTCTTCCTCTCTGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303601    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_013283.3-1219s21c1
Sequence:CCGGCTTAGGATCTTTCAGGTAAATCTCGAGATTTACCTGAAAGATCCTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134017
VALIDATED
MAT2B MISSION shRNA Bacterial Glycerol Stock
methionine adenosyltransferase II, beta
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134017.1-891s1c1
Sequence:CCGGGCAGCCACTTAAGACCTATTACTCGAGTAATAGGTCTTAAGTGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134017.1-464s1c1
Sequence:CCGGCTCATCTACATTAGCTCAGATCTCGAGATCTGAGCTAATGTAGATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134017.1-274s1c1
Sequence:CCGGCGAACAAGTGAACCTGTTGGACTCGAGTCCAACAGGTTCACTTGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134017.1-835s1c1
Sequence:CCGGGCAGATGACCAAGTATGAAATCTCGAGATTTCATACTTGGTCATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134017.1-688s1c1
Sequence:CCGGGTTCAGCAACAAGTCAGCAAACTCGAGTTTGCTGACTTGTTGCTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134017.1-835s21c1
Sequence:CCGGGCAGATGACCAAGTATGAAATCTCGAGATTTCATACTTGGTCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134017.1-891s21c1
Sequence:CCGGGCAGCCACTTAAGACCTATTACTCGAGTAATAGGTCTTAAGTGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134017.1-1275s21c1
Sequence:CCGGTTACCTCGCTATACAAGTAATCTCGAGATTACTTGTATAGCGAGGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134017.1-688s21c1
Sequence:CCGGGTTCAGCAACAAGTCAGCAAACTCGAGTTTGCTGACTTGTTGCTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134017
VALIDATED
MAT2B MISSION shRNA shRNA Plasmid DNA
methionine adenosyltransferase II, beta
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134017.1-891s1c1
Sequence:CCGGGCAGCCACTTAAGACCTATTACTCGAGTAATAGGTCTTAAGTGGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134017.1-464s1c1
Sequence:CCGGCTCATCTACATTAGCTCAGATCTCGAGATCTGAGCTAATGTAGATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134017.1-274s1c1
Sequence:CCGGCGAACAAGTGAACCTGTTGGACTCGAGTCCAACAGGTTCACTTGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134017.1-835s1c1
Sequence:CCGGGCAGATGACCAAGTATGAAATCTCGAGATTTCATACTTGGTCATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134017.1-688s1c1
Sequence:CCGGGTTCAGCAACAAGTCAGCAAACTCGAGTTTGCTGACTTGTTGCTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134017.1-835s21c1
Sequence:CCGGGCAGATGACCAAGTATGAAATCTCGAGATTTCATACTTGGTCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134017.1-891s21c1
Sequence:CCGGGCAGCCACTTAAGACCTATTACTCGAGTAATAGGTCTTAAGTGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134017.1-1275s21c1
Sequence:CCGGTTACCTCGCTATACAAGTAATCTCGAGATTACTTGTATAGCGAGGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134017.1-688s21c1
Sequence:CCGGGTTCAGCAACAAGTCAGCAAACTCGAGTTTGCTGACTTGTTGCTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134017
VALIDATED
MAT2B MISSION shRNA Lentiviral Transduction Particles
methionine adenosyltransferase II, beta
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134017.1-891s1c1
Sequence:CCGGGCAGCCACTTAAGACCTATTACTCGAGTAATAGGTCTTAAGTGGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134017.1-464s1c1
Sequence:CCGGCTCATCTACATTAGCTCAGATCTCGAGATCTGAGCTAATGTAGATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134017.1-274s1c1
Sequence:CCGGCGAACAAGTGAACCTGTTGGACTCGAGTCCAACAGGTTCACTTGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134017.1-835s1c1
Sequence:CCGGGCAGATGACCAAGTATGAAATCTCGAGATTTCATACTTGGTCATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134017.1-688s1c1
Sequence:CCGGGTTCAGCAACAAGTCAGCAAACTCGAGTTTGCTGACTTGTTGCTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134017.1-835s21c1
Sequence:CCGGGCAGATGACCAAGTATGAAATCTCGAGATTTCATACTTGGTCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134017.1-891s21c1
Sequence:CCGGGCAGCCACTTAAGACCTATTACTCGAGTAATAGGTCTTAAGTGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134017.1-1275s21c1
Sequence:CCGGTTACCTCGCTATACAAGTAATCTCGAGATTACTTGTATAGCGAGGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134017.1-688s21c1
Sequence:CCGGGTTCAGCAACAAGTCAGCAAACTCGAGTTTGCTGACTTGTTGCTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)