EMAIL THIS PAGE TO A FRIEND

MATK

megakaryocyte-associated tyrosine kinase

90 Gene Product Result for
Synonyms: CHK CTK HHYLTK HYL HYLTK Lsk
UniProtKB ID: P42679, B3KNZ9, Q9NST8
Gene ID:
Human(4145) Summary: The protein encoded by this gene has amino acid sequence similarity to Csk tyrosine kinase and has the structural features of the CSK subfamily: SRC homology SH2 and SH3 domains, a catalytic domain, a unique N terminus, lack of myristylation signals, lack of a negative regulatory phosphorylation site, and lack of an autophosphorylation site. This protein is thought to play a significant role in the signal transduction of hematopoietic cells. It is able to phosphorylate and inactivate Src family kinases, and may play an inhibitory role in the control of T-cell proliferation. This protein might be involved in signaling in some cases of breast cancer. Three alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(17179) megakaryocyte-associated tyrosine kinase
Rat(60450) megakaryocyte-associated tyrosine kinase
Zebrafish(567405) megakaryocyte-associated tyrosine kinase
Thale Cress(844797) maturase K
chicken(769076) megakaryocyte-associated tyrosine kinase
cow(504668) megakaryocyte-associated tyrosine kinase
domestic cat(101099024) megakaryocyte-associated tyrosine kinase
dog(611999) megakaryocyte-associated tyrosine kinase
domestic guinea pig(100729756) megakaryocyte-associated tyrosine kinase
naked mole-rat(101718779) megakaryocyte-associated tyrosine kinase
sheep(101117161) megakaryocyte-associated tyrosine kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010768 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010768 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010768 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002378 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002378 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002378 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU084441 MISSION® esiRNA esiRNA human MATK (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002378 Rosetta Predictions human pricing
NM_139354 Rosetta Predictions human pricing
NM_139355 Rosetta Predictions human pricing
NM_021859 Rosetta Predictions rat pricing
NM_010768 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002378 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238315 predicted 954
2 SASI_Hs01_00238316 predicted 949
3 SASI_Hs01_00238317 predicted 794
4 SASI_Hs02_00333717 predicted 885
5 SASI_Hs02_00333718 predicted 1516
6 SASI_Hs01_00238318 predicted 796
7 SASI_Hs01_00238320 predicted 1115
8 SASI_Hs01_00238321 predicted 1014
9 SASI_Hs01_00238322 predicted 1266
10 SASI_Hs01_00238324 predicted 872
11 SASI_Hs01_00238319 predicted 938
12 SASI_Hs01_00238323 predicted 1265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122628 predicted 791
2 SASI_Hs01_00122629 predicted 787
3 SASI_Hs01_00122630 predicted 634
4 SASI_Hs02_00364314 predicted 722
5 SASI_Hs02_00364315 predicted 1354
6 SASI_Hs01_00122631 predicted 637
7 SASI_Hs01_00122633 predicted 948
8 SASI_Hs01_00122634 predicted 851
9 SASI_Hs01_00122635 predicted 1107
10 SASI_Hs01_00122637 predicted 704
11 SASI_Hs01_00122632 predicted 774
12 SASI_Hs01_00122636 predicted 1102
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139355 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240042 predicted 1012
2 SASI_Hs01_00240043 predicted 1009
3 SASI_Hs01_00240044 predicted 858
4 SASI_Hs02_00364316 predicted 939
5 SASI_Hs02_00364317 predicted 1581
6 SASI_Hs01_00240045 predicted 861
7 SASI_Hs01_00240047 predicted 1178
8 SASI_Hs01_00240048 predicted 1078
9 SASI_Hs01_00240049 predicted 1330
10 SASI_Hs01_00240051 predicted 935
11 SASI_Hs01_00240046 predicted 999
12 SASI_Hs01_00240050 predicted 1324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021859 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110158 predicted 1373
2 SASI_Rn01_00110159 predicted 869
3 SASI_Rn01_00110160 predicted 1218
4 SASI_Rn01_00110161 predicted 1079
5 SASI_Rn01_00110162 predicted 626
6 SASI_Rn01_00110163 predicted 757
7 SASI_Rn01_00110165 predicted 961
8 SASI_Rn01_00110166 predicted 1036
9 SASI_Rn02_00262885 predicted 1128
10 SASI_Rn02_00262886 predicted 478
11 SASI_Rn01_00110164 predicted 961
12 SASI_Rn01_00110167 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010768 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148414 predicted 1189
2 SASI_Mm01_00148415 predicted 531
3 SASI_Mm01_00148416 predicted 1286
4 SASI_Mm01_00148417 predicted 1323
5 SASI_Mm01_00148418 predicted 230
6 SASI_Mm01_00148419 predicted 1330
7 SASI_Mm01_00148420 predicted 276
8 SASI_Mm01_00148421 predicted 714
9 SASI_Mm01_00148422 predicted 1148
10 SASI_Mm01_00148423 predicted 1326
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010768
MATK MISSION shRNA Bacterial Glycerol Stock
megakaryocyte-associated tyrosine kinase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010768.1-629s21c1
Sequence:CCGGATCGATGAGGCCGTGTGTTTCCTCGAGGAAACACACGGCCTCATCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010768.1-1096s21c1
Sequence:CCGGTGTTGCTGAAGGCATGGAATACTCGAGTATTCCATGCCTTCAGCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010768.1-1331s21c1
Sequence:CCGGTTGTGGGAAGTCTTCTCTTATCTCGAGATAAGAGAAGACTTCCCACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010768.1-163s21c1
Sequence:CCGGTCGGGTGAGCCCTAGATTGTTCTCGAGAACAATCTAGGGCTCACCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010768.1-640s1c1
Sequence:CCGGCGTGTGTTTCTGTAACCTGATCTCGAGATCAGGTTACAGAAACACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010768.1-171s1c1
Sequence:CCGGGCCCTAGATTGTTCGGAGCTTCTCGAGAAGCTCCGAACAATCTAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010768.1-1195s1c1
Sequence:CCGGCAGTGACTTTGGCTTAGCCAACTCGAGTTGGCTAAGCCAAAGTCACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010768.1-869s1c1
Sequence:CCGGGCTGTGAAGAATATCAAGTGTCTCGAGACACTTGATATTCTTCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010768.1-982s1c1
Sequence:CCGGCCACGGCTTGTACATTGTCATCTCGAGATGACAATGTACAAGCCGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010768
MATK MISSION shRNA shRNA Plasmid DNA
megakaryocyte-associated tyrosine kinase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010768.1-629s21c1
Sequence:CCGGATCGATGAGGCCGTGTGTTTCCTCGAGGAAACACACGGCCTCATCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010768.1-1096s21c1
Sequence:CCGGTGTTGCTGAAGGCATGGAATACTCGAGTATTCCATGCCTTCAGCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010768.1-1331s21c1
Sequence:CCGGTTGTGGGAAGTCTTCTCTTATCTCGAGATAAGAGAAGACTTCCCACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010768.1-163s21c1
Sequence:CCGGTCGGGTGAGCCCTAGATTGTTCTCGAGAACAATCTAGGGCTCACCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010768.1-640s1c1
Sequence:CCGGCGTGTGTTTCTGTAACCTGATCTCGAGATCAGGTTACAGAAACACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010768.1-171s1c1
Sequence:CCGGGCCCTAGATTGTTCGGAGCTTCTCGAGAAGCTCCGAACAATCTAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010768.1-1195s1c1
Sequence:CCGGCAGTGACTTTGGCTTAGCCAACTCGAGTTGGCTAAGCCAAAGTCACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010768.1-869s1c1
Sequence:CCGGGCTGTGAAGAATATCAAGTGTCTCGAGACACTTGATATTCTTCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010768.1-982s1c1
Sequence:CCGGCCACGGCTTGTACATTGTCATCTCGAGATGACAATGTACAAGCCGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010768
MATK MISSION shRNA Lentiviral Transduction Particles
megakaryocyte-associated tyrosine kinase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010768.1-629s21c1
Sequence:CCGGATCGATGAGGCCGTGTGTTTCCTCGAGGAAACACACGGCCTCATCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010768.1-1096s21c1
Sequence:CCGGTGTTGCTGAAGGCATGGAATACTCGAGTATTCCATGCCTTCAGCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010768.1-1331s21c1
Sequence:CCGGTTGTGGGAAGTCTTCTCTTATCTCGAGATAAGAGAAGACTTCCCACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010768.1-163s21c1
Sequence:CCGGTCGGGTGAGCCCTAGATTGTTCTCGAGAACAATCTAGGGCTCACCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010768.1-640s1c1
Sequence:CCGGCGTGTGTTTCTGTAACCTGATCTCGAGATCAGGTTACAGAAACACACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010768.1-171s1c1
Sequence:CCGGGCCCTAGATTGTTCGGAGCTTCTCGAGAAGCTCCGAACAATCTAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010768.1-1195s1c1
Sequence:CCGGCAGTGACTTTGGCTTAGCCAACTCGAGTTGGCTAAGCCAAAGTCACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010768.1-869s1c1
Sequence:CCGGGCTGTGAAGAATATCAAGTGTCTCGAGACACTTGATATTCTTCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010768.1-982s1c1
Sequence:CCGGCCACGGCTTGTACATTGTCATCTCGAGATGACAATGTACAAGCCGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002378
VALIDATED
MATK MISSION shRNA Bacterial Glycerol Stock
megakaryocyte-associated tyrosine kinase
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002378.3-807s21c1
Sequence:CCGGTACGTCCTGTGCGTGAGCTTTCTCGAGAAAGCTCACGCACAGGACGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002378.3-877s21c1
Sequence:CCGGCAATCGATGAGGCCGTGTTCTCTCGAGAGAACACGGCCTCATCGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002378.3-491s21c1
Sequence:CCGGCACCCAGTGTATCACCAAATGCTCGAGCATTTGGTGATACACTGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002378.3-961s21c1
Sequence:CCGGTGGTGAGACCAAAGCGGAAACCTCGAGGTTTCCGCTTTGGTCTCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002378.3-908s21c1
Sequence:CCGGCATGGACATGGTGGAGCATTACTCGAGTAATGCTCCACCATGTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002378.3-1026s21c1
Sequence:CCGGTTACTGAACCTGCAGCATTTGCTCGAGCAAATGCTGCAGGTTCAGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002378.3-1523s21c1
Sequence:CCGGGGCTCTCAAACACGGGAAGTTCTCGAGAACTTCCCGTGTTTGAGAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002378.2-1404s1c1
Sequence:CCGGGCCCGCAACATCCTGGTCTCACTCGAGTGAGACCAGGATGTTGCGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002378.2-590s1c1
Sequence:CCGGCAAGAGCTGGTACCGCGTCAACTCGAGTTGACGCGGTACCAGCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002378.x-1040s1c1
Sequence:CCGGGCATTTGACATTGGGAGCACACTCGAGTGTGCTCCCAATGTCAAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002378.x-1181s1c1
Sequence:CCGGGACGAAGATGCAACACGAGAACTCGAGTTCTCGTGTTGCATCTTCGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002378.x-1550s1c1
Sequence:CCGGCAAGTCGGATGTCTGGAGTTTCTCGAGAAACTCCAGACATCCGACTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002222    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002378.x-2060s1c1
Sequence:CCGGGACGGATTCTAAGGACTCTAACTCGAGTTAGAGTCCTTAGAATCCGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002378.x-896s1c1
Sequence:CCGGCTTCTGCAACCTCATGGACATCTCGAGATGTCCATGAGGTTGCAGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002378
VALIDATED
MATK MISSION shRNA shRNA Plasmid DNA
megakaryocyte-associated tyrosine kinase
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002378.3-807s21c1
Sequence:CCGGTACGTCCTGTGCGTGAGCTTTCTCGAGAAAGCTCACGCACAGGACGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002378.3-877s21c1
Sequence:CCGGCAATCGATGAGGCCGTGTTCTCTCGAGAGAACACGGCCTCATCGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002378.3-491s21c1
Sequence:CCGGCACCCAGTGTATCACCAAATGCTCGAGCATTTGGTGATACACTGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002378.3-961s21c1
Sequence:CCGGTGGTGAGACCAAAGCGGAAACCTCGAGGTTTCCGCTTTGGTCTCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002378.3-908s21c1
Sequence:CCGGCATGGACATGGTGGAGCATTACTCGAGTAATGCTCCACCATGTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002378.3-1026s21c1
Sequence:CCGGTTACTGAACCTGCAGCATTTGCTCGAGCAAATGCTGCAGGTTCAGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002378.3-1523s21c1
Sequence:CCGGGGCTCTCAAACACGGGAAGTTCTCGAGAACTTCCCGTGTTTGAGAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002378.2-1404s1c1
Sequence:CCGGGCCCGCAACATCCTGGTCTCACTCGAGTGAGACCAGGATGTTGCGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002378.2-590s1c1
Sequence:CCGGCAAGAGCTGGTACCGCGTCAACTCGAGTTGACGCGGTACCAGCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002378.x-1040s1c1
Sequence:CCGGGCATTTGACATTGGGAGCACACTCGAGTGTGCTCCCAATGTCAAATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002378.x-1181s1c1
Sequence:CCGGGACGAAGATGCAACACGAGAACTCGAGTTCTCGTGTTGCATCTTCGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002378.x-1550s1c1
Sequence:CCGGCAAGTCGGATGTCTGGAGTTTCTCGAGAAACTCCAGACATCCGACTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002222    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002378.x-2060s1c1
Sequence:CCGGGACGGATTCTAAGGACTCTAACTCGAGTTAGAGTCCTTAGAATCCGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002378.x-896s1c1
Sequence:CCGGCTTCTGCAACCTCATGGACATCTCGAGATGTCCATGAGGTTGCAGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002378
VALIDATED
MATK MISSION shRNA Lentiviral Transduction Particles
megakaryocyte-associated tyrosine kinase
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002378.3-807s21c1
Sequence:CCGGTACGTCCTGTGCGTGAGCTTTCTCGAGAAAGCTCACGCACAGGACGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002378.3-877s21c1
Sequence:CCGGCAATCGATGAGGCCGTGTTCTCTCGAGAGAACACGGCCTCATCGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002378.3-491s21c1
Sequence:CCGGCACCCAGTGTATCACCAAATGCTCGAGCATTTGGTGATACACTGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002378.3-961s21c1
Sequence:CCGGTGGTGAGACCAAAGCGGAAACCTCGAGGTTTCCGCTTTGGTCTCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002378.3-908s21c1
Sequence:CCGGCATGGACATGGTGGAGCATTACTCGAGTAATGCTCCACCATGTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002378.3-1026s21c1
Sequence:CCGGTTACTGAACCTGCAGCATTTGCTCGAGCAAATGCTGCAGGTTCAGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002378.3-1523s21c1
Sequence:CCGGGGCTCTCAAACACGGGAAGTTCTCGAGAACTTCCCGTGTTTGAGAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002378.2-1404s1c1
Sequence:CCGGGCCCGCAACATCCTGGTCTCACTCGAGTGAGACCAGGATGTTGCGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199107    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002378.2-590s1c1
Sequence:CCGGCAAGAGCTGGTACCGCGTCAACTCGAGTTGACGCGGTACCAGCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002378.x-1040s1c1
Sequence:CCGGGCATTTGACATTGGGAGCACACTCGAGTGTGCTCCCAATGTCAAATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002378.x-1181s1c1
Sequence:CCGGGACGAAGATGCAACACGAGAACTCGAGTTCTCGTGTTGCATCTTCGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002378.x-1550s1c1
Sequence:CCGGCAAGTCGGATGTCTGGAGTTTCTCGAGAAACTCCAGACATCCGACTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002222    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002378.x-2060s1c1
Sequence:CCGGGACGGATTCTAAGGACTCTAACTCGAGTTAGAGTCCTTAGAATCCGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002378.x-896s1c1
Sequence:CCGGCTTCTGCAACCTCATGGACATCTCGAGATGTCCATGAGGTTGCAGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)