EMAIL THIS PAGE TO A FRIEND

MATN1

matrilin 1, cartilage matrix protein

64 Gene Product Result for
Synonyms: CMP CRTM
UniProtKB ID: P21941, B2R7E3, Q5TBB9
Gene ID:
Human(4146) Summary: This gene encodes a member of von Willebrand factor A domain containing protein family. This family of proteins are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. Mutations of this gene have been associated with variety of inherited chondrodysplasias. [provided by RefSeq, Jul 2008]
Mouse(17180) matrilin 1, cartilage matrix protein
Rat(297894) matrilin 1, cartilage matrix protein
sheep(101108293) matrilin 1, cartilage matrix protein
naked mole-rat(101697617) matrilin 1, cartilage matrix protein
Domestic Rabbit(100349419) matrilin 1, cartilage matrix protein
domestic guinea pig(100714767) matrilin 1, cartilage matrix protein
Zebrafish(403023) matrilin 1
cow(512059) matrilin 1, cartilage matrix protein
domestic cat(101092626) matrilin 1, cartilage matrix protein
dog(487325) matrilin 1, cartilage matrix protein
chicken(396505) matrilin 1, cartilage matrix protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002379 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002379 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002379 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010769 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010769 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010769 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002379 Rosetta Predictions human pricing
NM_001006979 Rosetta Predictions rat pricing
NM_010769 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002379 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106468 predicted 1240
2 SASI_Hs01_00106469 predicted 1262
3 SASI_Hs01_00106470 predicted 1318
4 SASI_Hs01_00106471 predicted 1335
5 SASI_Hs01_00106472 predicted 1243
6 SASI_Hs01_00106475 predicted 1549
7 SASI_Hs01_00106476 predicted 604
8 SASI_Hs02_00333719 predicted 1730
9 SASI_Hs02_00333720 predicted 1443
10 SASI_Hs02_00333721 predicted 1508
11 SASI_Hs01_00106473 predicted 1876
12 SASI_Hs01_00106474 predicted 645
13 SASI_Hs01_00106477 predicted 1639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006979 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077193 predicted 781
2 SASI_Rn01_00077194 predicted 867
3 SASI_Rn02_00198546 predicted 501
4 SASI_Rn01_00077195 predicted 1003
5 SASI_Rn01_00077197 predicted 919
6 SASI_Rn01_00077198 predicted 543
7 SASI_Rn01_00077199 predicted 208
8 SASI_Rn01_00077200 predicted 1034
9 SASI_Rn02_00198547 predicted 771
10 SASI_Rn01_00077201 predicted 1506
11 SASI_Rn01_00077196 predicted 1615
12 SASI_Rn01_00077202 predicted 928
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010769 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164915 predicted 1170
2 SASI_Mm01_00164916 predicted 1129
3 SASI_Mm01_00164917 predicted 1125
4 SASI_Mm02_00319307 predicted 1279
5 SASI_Mm01_00164919 predicted 944
6 SASI_Mm01_00164921 predicted 1116
7 SASI_Mm01_00164922 predicted 791
8 SASI_Mm02_00319308 predicted 1508
9 SASI_Mm01_00164923 predicted 1069
10 SASI_Mm01_00164924 predicted 560
11 SASI_Mm01_00164918 predicted 453
12 SASI_Mm01_00164920 predicted 1085
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002379
MATN1 MISSION shRNA Bacterial Glycerol Stock
matrilin 1, cartilage matrix protein
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002379.2-1875s1c1
Sequence:CCGGCCTGGTGAAATTCCAAGCCAACTCGAGTTGGCTTGGAATTTCACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002379.2-2204s1c1
Sequence:CCGGGCATGAGTCTTGCCAGAATGTCTCGAGACATTCTGGCAAGACTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002379.2-1371s1c1
Sequence:CCGGGAAGAAGTTCATCAGTCAGATCTCGAGATCTGACTGATGAACTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002379.2-648s1c1
Sequence:CCGGGCCTGTTGAATTTGAGAAAGTCTCGAGACTTTCTCAAATTCAACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002379.2-646s1c1
Sequence:CCGGCGGCCTGTTGAATTTGAGAAACTCGAGTTTCTCAAATTCAACAGGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002379.2-1735s1c1
Sequence:CCGGGAGGATGAGCTGAGGGAAATACTCGAGTATTTCCCTCAGCTCATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002379.2-2216s1c1
Sequence:CCGGCCAGAATGTGAGTGTGAGAGTCTCGAGACTCTCACACTCACATTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002379.2-1515s1c1
Sequence:CCGGGCGGAATATGTCCTACATGGACTCGAGTCCATGTAGGACATATTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002379.2-1959s1c1
Sequence:CCGGCCTGGAGAACACAGTTGTCTACTCGAGTAGACAACTGTGTTCTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002379.2-1695s1c1
Sequence:CCGGCGGCTTTAAGATGTTTGCTGTCTCGAGACAGCAAACATCTTAAAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002379.2-1815s1c1
Sequence:CCGGGATAGGCAAGAAGTTGCAGAACTCGAGTTCTGCAACTTCTTGCCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002379
MATN1 MISSION shRNA shRNA Plasmid DNA
matrilin 1, cartilage matrix protein
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002379.2-1875s1c1
Sequence:CCGGCCTGGTGAAATTCCAAGCCAACTCGAGTTGGCTTGGAATTTCACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002379.2-2204s1c1
Sequence:CCGGGCATGAGTCTTGCCAGAATGTCTCGAGACATTCTGGCAAGACTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002379.2-1371s1c1
Sequence:CCGGGAAGAAGTTCATCAGTCAGATCTCGAGATCTGACTGATGAACTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002379.2-648s1c1
Sequence:CCGGGCCTGTTGAATTTGAGAAAGTCTCGAGACTTTCTCAAATTCAACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002379.2-646s1c1
Sequence:CCGGCGGCCTGTTGAATTTGAGAAACTCGAGTTTCTCAAATTCAACAGGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002379.2-1735s1c1
Sequence:CCGGGAGGATGAGCTGAGGGAAATACTCGAGTATTTCCCTCAGCTCATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002379.2-2216s1c1
Sequence:CCGGCCAGAATGTGAGTGTGAGAGTCTCGAGACTCTCACACTCACATTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002379.2-1515s1c1
Sequence:CCGGGCGGAATATGTCCTACATGGACTCGAGTCCATGTAGGACATATTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002379.2-1959s1c1
Sequence:CCGGCCTGGAGAACACAGTTGTCTACTCGAGTAGACAACTGTGTTCTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002379.2-1695s1c1
Sequence:CCGGCGGCTTTAAGATGTTTGCTGTCTCGAGACAGCAAACATCTTAAAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002379.2-1815s1c1
Sequence:CCGGGATAGGCAAGAAGTTGCAGAACTCGAGTTCTGCAACTTCTTGCCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002379
MATN1 MISSION shRNA Lentiviral Transduction Particles
matrilin 1, cartilage matrix protein
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002379.2-1875s1c1
Sequence:CCGGCCTGGTGAAATTCCAAGCCAACTCGAGTTGGCTTGGAATTTCACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002379.2-2204s1c1
Sequence:CCGGGCATGAGTCTTGCCAGAATGTCTCGAGACATTCTGGCAAGACTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002379.2-1371s1c1
Sequence:CCGGGAAGAAGTTCATCAGTCAGATCTCGAGATCTGACTGATGAACTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002379.2-648s1c1
Sequence:CCGGGCCTGTTGAATTTGAGAAAGTCTCGAGACTTTCTCAAATTCAACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002379.2-646s1c1
Sequence:CCGGCGGCCTGTTGAATTTGAGAAACTCGAGTTTCTCAAATTCAACAGGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002379.2-1735s1c1
Sequence:CCGGGAGGATGAGCTGAGGGAAATACTCGAGTATTTCCCTCAGCTCATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002379.2-2216s1c1
Sequence:CCGGCCAGAATGTGAGTGTGAGAGTCTCGAGACTCTCACACTCACATTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002379.2-1515s1c1
Sequence:CCGGGCGGAATATGTCCTACATGGACTCGAGTCCATGTAGGACATATTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002379.2-1959s1c1
Sequence:CCGGCCTGGAGAACACAGTTGTCTACTCGAGTAGACAACTGTGTTCTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002379.2-1695s1c1
Sequence:CCGGCGGCTTTAAGATGTTTGCTGTCTCGAGACAGCAAACATCTTAAAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002379.2-1815s1c1
Sequence:CCGGGATAGGCAAGAAGTTGCAGAACTCGAGTTCTGCAACTTCTTGCCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010769
MATN1 MISSION shRNA Bacterial Glycerol Stock
matrilin 1, cartilage matrix protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010769.1-618s1c1
Sequence:CCGGCGTGGAGAGCTACAATGTCATCTCGAGATGACATTGTAGCTCTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010769.1-1078s1c1
Sequence:CCGGGCCGCCTTGAAGTATCTCATACTCGAGTATGAGATACTTCAAGGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010769.1-1482s1c1
Sequence:CCGGCCTGGAGAACAGAATCATCTACTCGAGTAGATGATTCTGTTCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010769.1-1353s1c1
Sequence:CCGGGCAGAAACAAATCTGTGTGGACTCGAGTCCACACAGATTTGTTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010769.1-1527s1c1
Sequence:CCGGCCACCCAATGCACAGTTCTTACTCGAGTAAGAACTGTGCATTGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010769
MATN1 MISSION shRNA shRNA Plasmid DNA
matrilin 1, cartilage matrix protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010769.1-618s1c1
Sequence:CCGGCGTGGAGAGCTACAATGTCATCTCGAGATGACATTGTAGCTCTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010769.1-1078s1c1
Sequence:CCGGGCCGCCTTGAAGTATCTCATACTCGAGTATGAGATACTTCAAGGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010769.1-1482s1c1
Sequence:CCGGCCTGGAGAACAGAATCATCTACTCGAGTAGATGATTCTGTTCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010769.1-1353s1c1
Sequence:CCGGGCAGAAACAAATCTGTGTGGACTCGAGTCCACACAGATTTGTTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010769.1-1527s1c1
Sequence:CCGGCCACCCAATGCACAGTTCTTACTCGAGTAAGAACTGTGCATTGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010769
MATN1 MISSION shRNA Lentiviral Transduction Particles
matrilin 1, cartilage matrix protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010769.1-618s1c1
Sequence:CCGGCGTGGAGAGCTACAATGTCATCTCGAGATGACATTGTAGCTCTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010769.1-1078s1c1
Sequence:CCGGGCCGCCTTGAAGTATCTCATACTCGAGTATGAGATACTTCAAGGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010769.1-1482s1c1
Sequence:CCGGCCTGGAGAACAGAATCATCTACTCGAGTAGATGATTCTGTTCTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010769.1-1353s1c1
Sequence:CCGGGCAGAAACAAATCTGTGTGGACTCGAGTCCACACAGATTTGTTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010769.1-1527s1c1
Sequence:CCGGCCACCCAATGCACAGTTCTTACTCGAGTAAGAACTGTGCATTGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)