EMAIL THIS PAGE TO A FRIEND

MATN2

matrilin 2

86 Gene Product Result for
Gene ID:
Human(4147) Summary: This gene encodes a member of the von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This protein contains five von Willebrand factor A domains. The specific function of this gene has not yet been determined. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(17181) matrilin 2
Rat(299996) matrilin 2
chicken(426584) matrilin 2
dog(491431) matrilin 2
Horse(100055555) matrilin 2
cow(781953) matrilin 2
sheep(101107106) matrilin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016762 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016762 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016762 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002380 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002380 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002380 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002380 Rosetta Predictions human pricing
NM_030583 Rosetta Predictions human pricing
XM_001058523 Rosetta Predictions rat pricing
XM_216941 Rosetta Predictions rat pricing
NM_016762 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002380 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084101 predicted 881
2 SASI_Hs01_00084102 predicted 3163
3 SASI_Hs02_00333722 predicted 1883
4 SASI_Hs01_00084104 predicted 3138
5 SASI_Hs01_00084105 predicted 2186
6 SASI_Hs02_00333723 predicted 1315
7 SASI_Hs01_00084106 predicted 1985
8 SASI_Hs01_00084107 predicted 1325
9 SASI_Hs01_00084108 predicted 2119
10 SASI_Hs02_00333724 predicted 2395
11 SASI_Hs01_00084099 predicted 3191
12 SASI_Hs01_00084100 predicted 2171
13 SASI_Hs01_00084103 predicted 1321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030583 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038390 predicted 887
2 SASI_Hs01_00038391 predicted 3106
3 SASI_Hs02_00358156 predicted 1886
4 SASI_Hs01_00038393 predicted 3083
5 SASI_Hs01_00038394 predicted 2177
6 SASI_Hs02_00358157 predicted 1309
7 SASI_Hs01_00038395 predicted 1980
8 SASI_Hs01_00038396 predicted 1325
9 SASI_Hs01_00038397 predicted 2114
10 SASI_Hs02_00358158 predicted 2395
11 SASI_Hs01_00038388 predicted 3138
12 SASI_Hs01_00038389 predicted 2168
13 SASI_Hs01_00038392 predicted 1321
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058523 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290006 predicted 2050
2 SASI_Rn02_00290007 predicted 2345
3 SASI_Rn02_00290008 predicted 1056
4 SASI_Rn02_00290009 predicted 873
5 SASI_Rn02_00290010 predicted 1841
6 SASI_Rn02_00290011 predicted 733
7 SASI_Rn02_00290012 predicted 1065
8 SASI_Rn02_00290013 predicted 2782
9 SASI_Rn02_00290014 predicted 2758
10 SASI_Rn02_00290015 predicted 2820
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216941 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376927 predicted 732
2 SASI_Rn02_00376928 predicted 1222
3 SASI_Rn02_00376929 predicted 1037
4 SASI_Rn02_00376930 predicted 902
5 SASI_Rn02_00376931 predicted 1234
6 SASI_Rn02_00376932 predicted 1525
7 SASI_Rn02_00376933 predicted 1614
8 SASI_Rn02_00376934 predicted 992
9 SASI_Rn02_00376935 predicted 1167
10 SASI_Rn02_00376936 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016762 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061925 predicted 388
2 SASI_Mm01_00061926 predicted 1648
3 SASI_Mm01_00061927 predicted 413
4 SASI_Mm01_00061928 predicted 1330
5 SASI_Mm01_00061930 predicted 2204
6 SASI_Mm01_00061931 predicted 903
7 SASI_Mm01_00061932 predicted 1299
8 SASI_Mm01_00061933 predicted 1699
9 SASI_Mm02_00323513 predicted 2632
10 SASI_Mm01_00061934 predicted 580
11 SASI_Mm01_00061929 predicted 2273
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016762
VALIDATED
MATN2 MISSION shRNA Bacterial Glycerol Stock
matrilin 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016762.1-2600s1c1
Sequence:CCGGGCCAATGGTATCACTATGTATCTCGAGATACATAGTGATACCATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016762.1-470s1c1
Sequence:CCGGGCAAAGGTCAAGGAGTTCATTCTCGAGAATGAACTCCTTGACCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016762.1-2839s1c1
Sequence:CCGGGCCAGTCACCATAAAGATCAACTCGAGTTGATCTTTATGGTGACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016762.1-2419s1c1
Sequence:CCGGCCACATGAAATACATGGGCAACTCGAGTTGCCCATGTATTTCATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016762.2-2710s21c1
Sequence:CCGGTCAGCACAATGGGCGAAATAACTCGAGTTATTTCGCCCATTGTGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016762.2-1298s21c1
Sequence:CCGGATTTGCTCTTAACAGCGATAACTCGAGTTATCGCTGTTAAGAGCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016762.2-1324s21c1
Sequence:CCGGCATGCTCAAAGATTGACTATTCTCGAGAATAGTCAATCTTTGAGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016762.2-451s21c1
Sequence:CCGGGTGTCAACACCTATGACTATGCTCGAGCATAGTCATAGGTGTTGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016762.2-3323s21c1
Sequence:CCGGCGGTGTACTGTGGACATAATTCTCGAGAATTATGTCCACAGTACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016762
VALIDATED
MATN2 MISSION shRNA shRNA Plasmid DNA
matrilin 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016762.1-2600s1c1
Sequence:CCGGGCCAATGGTATCACTATGTATCTCGAGATACATAGTGATACCATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016762.1-470s1c1
Sequence:CCGGGCAAAGGTCAAGGAGTTCATTCTCGAGAATGAACTCCTTGACCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016762.1-2839s1c1
Sequence:CCGGGCCAGTCACCATAAAGATCAACTCGAGTTGATCTTTATGGTGACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016762.1-2419s1c1
Sequence:CCGGCCACATGAAATACATGGGCAACTCGAGTTGCCCATGTATTTCATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016762.2-2710s21c1
Sequence:CCGGTCAGCACAATGGGCGAAATAACTCGAGTTATTTCGCCCATTGTGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016762.2-1298s21c1
Sequence:CCGGATTTGCTCTTAACAGCGATAACTCGAGTTATCGCTGTTAAGAGCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016762.2-1324s21c1
Sequence:CCGGCATGCTCAAAGATTGACTATTCTCGAGAATAGTCAATCTTTGAGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016762.2-451s21c1
Sequence:CCGGGTGTCAACACCTATGACTATGCTCGAGCATAGTCATAGGTGTTGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016762.2-3323s21c1
Sequence:CCGGCGGTGTACTGTGGACATAATTCTCGAGAATTATGTCCACAGTACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016762
VALIDATED
MATN2 MISSION shRNA Lentiviral Transduction Particles
matrilin 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016762.1-2600s1c1
Sequence:CCGGGCCAATGGTATCACTATGTATCTCGAGATACATAGTGATACCATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016762.1-470s1c1
Sequence:CCGGGCAAAGGTCAAGGAGTTCATTCTCGAGAATGAACTCCTTGACCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016762.1-2839s1c1
Sequence:CCGGGCCAGTCACCATAAAGATCAACTCGAGTTGATCTTTATGGTGACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016762.1-2419s1c1
Sequence:CCGGCCACATGAAATACATGGGCAACTCGAGTTGCCCATGTATTTCATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016762.2-2710s21c1
Sequence:CCGGTCAGCACAATGGGCGAAATAACTCGAGTTATTTCGCCCATTGTGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016762.2-1298s21c1
Sequence:CCGGATTTGCTCTTAACAGCGATAACTCGAGTTATCGCTGTTAAGAGCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016762.2-1324s21c1
Sequence:CCGGCATGCTCAAAGATTGACTATTCTCGAGAATAGTCAATCTTTGAGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016762.2-451s21c1
Sequence:CCGGGTGTCAACACCTATGACTATGCTCGAGCATAGTCATAGGTGTTGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317323    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_016762.2-3323s21c1
Sequence:CCGGCGGTGTACTGTGGACATAATTCTCGAGAATTATGTCCACAGTACACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002380
MATN2 MISSION shRNA Bacterial Glycerol Stock
matrilin 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002380.2-2294s1c1
Sequence:CCGGCCACATGAAATACATGGGAAACTCGAGTTTCCCATGTATTTCATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002380.2-2470s1c1
Sequence:CCGGCCAAGGCCAATGGTATCACTACTCGAGTAGTGATACCATTGGCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002380.2-716s1c1
Sequence:CCGGCCAGGTAGACTTCAACACCTTCTCGAGAAGGTGTTGAAGTCTACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002380.2-1162s1c1
Sequence:CCGGGCCATGAAGGATTTGCTCTTACTCGAGTAAGAGCAAATCCTTCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002380.2-1978s1c1
Sequence:CCGGGCGAACACATTTGTGTTAATACTCGAGTATTAACACAAATGTGTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002380.3-2815s21c1
Sequence:CCGGTCTGAGCCAGTCACCATAAATCTCGAGATTTATGGTGACTGGCTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002380.3-3115s21c1
Sequence:CCGGGCGACACATTTGTAGTCATTGCTCGAGCAATGACTACAAATGTGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002380
MATN2 MISSION shRNA shRNA Plasmid DNA
matrilin 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002380.2-2294s1c1
Sequence:CCGGCCACATGAAATACATGGGAAACTCGAGTTTCCCATGTATTTCATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002380.2-2470s1c1
Sequence:CCGGCCAAGGCCAATGGTATCACTACTCGAGTAGTGATACCATTGGCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002380.2-716s1c1
Sequence:CCGGCCAGGTAGACTTCAACACCTTCTCGAGAAGGTGTTGAAGTCTACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002380.2-1162s1c1
Sequence:CCGGGCCATGAAGGATTTGCTCTTACTCGAGTAAGAGCAAATCCTTCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002380.2-1978s1c1
Sequence:CCGGGCGAACACATTTGTGTTAATACTCGAGTATTAACACAAATGTGTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002380.3-2815s21c1
Sequence:CCGGTCTGAGCCAGTCACCATAAATCTCGAGATTTATGGTGACTGGCTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002380.3-3115s21c1
Sequence:CCGGGCGACACATTTGTAGTCATTGCTCGAGCAATGACTACAAATGTGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002380
MATN2 MISSION shRNA Lentiviral Transduction Particles
matrilin 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002380.2-2294s1c1
Sequence:CCGGCCACATGAAATACATGGGAAACTCGAGTTTCCCATGTATTTCATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002380.2-2470s1c1
Sequence:CCGGCCAAGGCCAATGGTATCACTACTCGAGTAGTGATACCATTGGCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002380.2-716s1c1
Sequence:CCGGCCAGGTAGACTTCAACACCTTCTCGAGAAGGTGTTGAAGTCTACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002380.2-1162s1c1
Sequence:CCGGGCCATGAAGGATTTGCTCTTACTCGAGTAAGAGCAAATCCTTCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002380.2-1978s1c1
Sequence:CCGGGCGAACACATTTGTGTTAATACTCGAGTATTAACACAAATGTGTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002380.3-2815s21c1
Sequence:CCGGTCTGAGCCAGTCACCATAAATCTCGAGATTTATGGTGACTGGCTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372965    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002380.3-3115s21c1
Sequence:CCGGGCGACACATTTGTAGTCATTGCTCGAGCAATGACTACAAATGTGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)