EMAIL THIS PAGE TO A FRIEND

MATN3

matrilin 3

55 Gene Product Result for
Synonyms: DIPOA EDM5 HOA OADIP OS2
UniProtKB ID: O15232, Q4ZG02
Gene ID:
Human(4148) Summary: This gene encodes a member of von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This protein contains two von Willebrand factor A domains; it is present in the cartilage extracellular matrix and has a role in the development and homeostasis of cartilage and bone. Mutations in this gene result in multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]
Mouse(17182) matrilin 3
Rat(313954) matrilin 3
sheep(101106581) matrilin 3
chicken(395954) matrilin 3
cow(540041) matrilin 3
Horse(100071902) matrilin 3
dog(482985) matrilin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002381 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002381 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002381 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010770 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010770 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010770 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002381 Rosetta Predictions human pricing
NM_001108013 Rosetta Predictions rat pricing
NM_010770 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216773 predicted 507
2 SASI_Hs01_00216774 predicted 980
3 SASI_Hs01_00216775 predicted 443
4 SASI_Hs01_00216776 predicted 1052
5 SASI_Hs01_00216777 predicted 991
6 SASI_Hs01_00216778 predicted 397
7 SASI_Hs01_00216779 predicted 1178
8 SASI_Hs01_00216781 predicted 696
9 SASI_Hs01_00216782 predicted 1498
10 SASI_Hs02_00333725 predicted 1037
11 SASI_Hs01_00216780 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108013 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234505 predicted 1344
2 SASI_Rn02_00234506 predicted 345
3 SASI_Rn02_00234507 predicted 1531
4 SASI_Rn02_00234508 predicted 966
5 SASI_Rn02_00234509 predicted 1516
6 SASI_Rn02_00234510 predicted 1349
7 SASI_Rn02_00234511 predicted 864
8 SASI_Rn02_00234512 predicted 1541
9 SASI_Rn02_00234513 predicted 1220
10 SASI_Rn02_00234514 predicted 774
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010770 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178515 predicted 1468
2 SASI_Mm01_00178516 predicted 283
3 SASI_Mm01_00178518 predicted 1306
4 SASI_Mm01_00178519 predicted 441
5 SASI_Mm01_00178520 predicted 1313
6 SASI_Mm02_00319309 predicted 1555
7 SASI_Mm01_00178521 predicted 1079
8 SASI_Mm01_00178522 predicted 705
9 SASI_Mm01_00178523 predicted 1583
10 SASI_Mm01_00178524 predicted 1459
11 SASI_Mm01_00178517 predicted 924
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002381
MATN3 MISSION shRNA Bacterial Glycerol Stock
matrilin 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002381.4-1554s21c1
Sequence:CCGGGACAGCTTGGTGTACTTAATACTCGAGTATTAAGTACACCAAGCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002381.4-389s21c1
Sequence:CCGGTAATCGACACTCTGGACATTGCTCGAGCAATGTCCAGAGTGTCGATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002381.4-1313s21c1
Sequence:CCGGGCTATCCTGGCTACACCTTAACTCGAGTTAAGGTGTAGCCAGGATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002381.2-609s1c1
Sequence:CCGGGCCCTCTTCTAACATCCCTAACTCGAGTTAGGGATGTTAGAAGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002381.2-979s1c1
Sequence:CCGGGCTCTTGATAGGTGTGCTCTTCTCGAGAAGAGCACACCTATCAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002381.2-1196s1c1
Sequence:CCGGGCTACACTCTGAATGCAGATACTCGAGTATCTGCATTCAGAGTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002381.2-311s1c1
Sequence:CCGGACCTGGTGTTTATCATTGATACTCGAGTATCAATGATAAACACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002381.2-1372s1c1
Sequence:CCGGCGAAGACTTGTTTCCACTGAACTCGAGTTCAGTGGAAACAAGTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002381
MATN3 MISSION shRNA shRNA Plasmid DNA
matrilin 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002381.4-1554s21c1
Sequence:CCGGGACAGCTTGGTGTACTTAATACTCGAGTATTAAGTACACCAAGCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002381.4-389s21c1
Sequence:CCGGTAATCGACACTCTGGACATTGCTCGAGCAATGTCCAGAGTGTCGATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002381.4-1313s21c1
Sequence:CCGGGCTATCCTGGCTACACCTTAACTCGAGTTAAGGTGTAGCCAGGATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002381.2-609s1c1
Sequence:CCGGGCCCTCTTCTAACATCCCTAACTCGAGTTAGGGATGTTAGAAGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002381.2-979s1c1
Sequence:CCGGGCTCTTGATAGGTGTGCTCTTCTCGAGAAGAGCACACCTATCAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002381.2-1196s1c1
Sequence:CCGGGCTACACTCTGAATGCAGATACTCGAGTATCTGCATTCAGAGTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002381.2-311s1c1
Sequence:CCGGACCTGGTGTTTATCATTGATACTCGAGTATCAATGATAAACACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002381.2-1372s1c1
Sequence:CCGGCGAAGACTTGTTTCCACTGAACTCGAGTTCAGTGGAAACAAGTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002381
MATN3 MISSION shRNA Lentiviral Transduction Particles
matrilin 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432943    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002381.4-1554s21c1
Sequence:CCGGGACAGCTTGGTGTACTTAATACTCGAGTATTAAGTACACCAAGCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002381.4-389s21c1
Sequence:CCGGTAATCGACACTCTGGACATTGCTCGAGCAATGTCCAGAGTGTCGATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002381.4-1313s21c1
Sequence:CCGGGCTATCCTGGCTACACCTTAACTCGAGTTAAGGTGTAGCCAGGATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002381.2-609s1c1
Sequence:CCGGGCCCTCTTCTAACATCCCTAACTCGAGTTAGGGATGTTAGAAGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002381.2-979s1c1
Sequence:CCGGGCTCTTGATAGGTGTGCTCTTCTCGAGAAGAGCACACCTATCAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002381.2-1196s1c1
Sequence:CCGGGCTACACTCTGAATGCAGATACTCGAGTATCTGCATTCAGAGTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002381.2-311s1c1
Sequence:CCGGACCTGGTGTTTATCATTGATACTCGAGTATCAATGATAAACACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002381.2-1372s1c1
Sequence:CCGGCGAAGACTTGTTTCCACTGAACTCGAGTTCAGTGGAAACAAGTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010770
MATN3 MISSION shRNA Bacterial Glycerol Stock
matrilin 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119452    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010770.2-1573s1c1
Sequence:CCGGGCCTGCTAATAATCTGCCATTCTCGAGAATGGCAGATTATTAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010770.2-1425s1c1
Sequence:CCGGGCTGAACACCAAACTTGACAACTCGAGTTGTCAAGTTTGGTGTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010770.2-273s1c1
Sequence:CCGGGCCTTTGGACTTGGTGTTCATCTCGAGATGAACACCAAGTCCAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010770.2-321s1c1
Sequence:CCGGTCTGGAATTCACCAAGGTGAACTCGAGTTCACCTTGGTGAATTCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010770.3-1697s21c1
Sequence:CCGGGGTTTCTGGAGAACCATATTGCTCGAGCAATATGGTTCTCCAGAAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010770
MATN3 MISSION shRNA shRNA Plasmid DNA
matrilin 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119452    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010770.2-1573s1c1
Sequence:CCGGGCCTGCTAATAATCTGCCATTCTCGAGAATGGCAGATTATTAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010770.2-1425s1c1
Sequence:CCGGGCTGAACACCAAACTTGACAACTCGAGTTGTCAAGTTTGGTGTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010770.2-273s1c1
Sequence:CCGGGCCTTTGGACTTGGTGTTCATCTCGAGATGAACACCAAGTCCAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010770.2-321s1c1
Sequence:CCGGTCTGGAATTCACCAAGGTGAACTCGAGTTCACCTTGGTGAATTCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000454999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010770.3-1697s21c1
Sequence:CCGGGGTTTCTGGAGAACCATATTGCTCGAGCAATATGGTTCTCCAGAAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010770
MATN3 MISSION shRNA Lentiviral Transduction Particles
matrilin 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119452    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010770.2-1573s1c1
Sequence:CCGGGCCTGCTAATAATCTGCCATTCTCGAGAATGGCAGATTATTAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010770.2-1425s1c1
Sequence:CCGGGCTGAACACCAAACTTGACAACTCGAGTTGTCAAGTTTGGTGTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010770.2-273s1c1
Sequence:CCGGGCCTTTGGACTTGGTGTTCATCTCGAGATGAACACCAAGTCCAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010770.2-321s1c1
Sequence:CCGGTCTGGAATTCACCAAGGTGAACTCGAGTTCACCTTGGTGAATTCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010770.3-1697s21c1
Sequence:CCGGGGTTTCTGGAGAACCATATTGCTCGAGCAATATGGTTCTCCAGAAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)