EMAIL THIS PAGE TO A FRIEND

MATN4

matrilin 4

70 Gene Product Result for
Gene ID:
Human(8785) Summary: This gene encodes a member of von Willebrand factor A domain-containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This family member is thought to be play a role in reorganizing and regenerating the corneal matrix in granular and lattice type I dystrophies. It may also be involved in wound healing in the dentin-pulp complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Mouse(17183) matrilin 4
Rat(296358) matrilin 4
Zebrafish(497348) matrilin 4
chicken(428140) matrilin 4
dog(485891) matrilin 4
Horse(100070904) matrilin 4
cow(100139180) matrilin 4
sheep(101108412) matrilin 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003833 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003833 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003833 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013592 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013592 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013592 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003833 Rosetta Predictions human pricing
NM_030590 Rosetta Predictions human pricing
NM_030592 Rosetta Predictions human pricing
NM_001106539 Rosetta Predictions rat pricing
NM_013592 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070333 predicted 1628
2 SASI_Hs01_00070334 predicted 1357
3 SASI_Hs01_00070335 predicted 227
4 SASI_Hs01_00070336 predicted 1265
5 SASI_Hs01_00070337 predicted 1343
6 SASI_Hs02_00336391 predicted 276
7 SASI_Hs01_00070338 predicted 344
8 SASI_Hs01_00070339 predicted 336
9 SASI_Hs01_00070340 predicted 1606
10 SASI_Hs01_00070341 predicted 1112
11 SASI_Hs01_00070342 predicted 1593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030590 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124139 predicted 1510
2 SASI_Hs01_00124140 predicted 1229
3 SASI_Hs01_00124141 predicted 226
4 SASI_Hs01_00124142 predicted 1148
5 SASI_Hs01_00124143 predicted 1218
6 SASI_Hs02_00358159 predicted 277
7 SASI_Hs01_00124144 predicted 343
8 SASI_Hs01_00124145 predicted 332
9 SASI_Hs01_00124146 predicted 1485
10 SASI_Hs01_00124147 predicted 990
11 SASI_Hs01_00124148 predicted 1467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030592 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088524 predicted 1381
2 SASI_Hs01_00088525 predicted 1110
3 SASI_Hs01_00088526 predicted 233
4 SASI_Hs01_00088527 predicted 1025
5 SASI_Hs01_00088528 predicted 1091
6 SASI_Hs02_00358160 predicted 277
7 SASI_Hs01_00088529 predicted 346
8 SASI_Hs01_00088530 predicted 340
9 SASI_Hs01_00088531 predicted 1362
10 SASI_Hs01_00088532 predicted 863
11 SASI_Hs01_00088533 predicted 1346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106539 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219948 predicted 909
2 SASI_Rn02_00219949 predicted 975
3 SASI_Rn02_00219950 predicted 917
4 SASI_Rn02_00219951 predicted 1827
5 SASI_Rn02_00219952 predicted 255
6 SASI_Rn02_00219953 predicted 895
7 SASI_Rn02_00219954 predicted 985
8 SASI_Rn02_00219955 predicted 928
9 SASI_Rn02_00219956 predicted 651
10 SASI_Rn02_00219957 predicted 1705
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013592 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047997 predicted 833
2 SASI_Mm01_00047998 predicted 853
3 SASI_Mm01_00047999 predicted 204
4 SASI_Mm01_00048000 predicted 338
5 SASI_Mm01_00048001 predicted 603
6 SASI_Mm01_00048002 predicted 604
7 SASI_Mm01_00048003 predicted 1745
8 SASI_Mm01_00048004 predicted 337
9 SASI_Mm01_00048005 predicted 841
10 SASI_Mm01_00048006 predicted 808
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003833
MATN4 MISSION shRNA Bacterial Glycerol Stock
matrilin 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003833.2-1117s1c1
Sequence:CCGGCAGATTGTGGACTTCCTAGATCTCGAGATCTAGGAAGTCCACAATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003833.3-2070s21c1
Sequence:CCGGTCCGGCATTGAGCTGAGTTGGCTCGAGCCAACTCAGCTCAATGCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003833.3-1281s21c1
Sequence:CCGGAGCGCTTCGTGAACCAGATTGCTCGAGCAATCTGGTTCACGAAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003833.3-285s21c1
Sequence:CCGGTGGATCTGGTGTTCGTGATTGCTCGAGCAATCACGAACACCAGATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003833.3-402s21c1
Sequence:CCGGGCGTTGGCGTGATCCAGTATTCTCGAGAATACTGGATCACGCCAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003833.3-864s21c1
Sequence:CCGGGTGAGCACCACTGCGTCAATTCTCGAGAATTGACGCAGTGGTGCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003833
MATN4 MISSION shRNA shRNA Plasmid DNA
matrilin 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003833.2-1117s1c1
Sequence:CCGGCAGATTGTGGACTTCCTAGATCTCGAGATCTAGGAAGTCCACAATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003833.3-2070s21c1
Sequence:CCGGTCCGGCATTGAGCTGAGTTGGCTCGAGCCAACTCAGCTCAATGCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003833.3-1281s21c1
Sequence:CCGGAGCGCTTCGTGAACCAGATTGCTCGAGCAATCTGGTTCACGAAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003833.3-285s21c1
Sequence:CCGGTGGATCTGGTGTTCGTGATTGCTCGAGCAATCACGAACACCAGATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003833.3-402s21c1
Sequence:CCGGGCGTTGGCGTGATCCAGTATTCTCGAGAATACTGGATCACGCCAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003833.3-864s21c1
Sequence:CCGGGTGAGCACCACTGCGTCAATTCTCGAGAATTGACGCAGTGGTGCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003833
MATN4 MISSION shRNA Lentiviral Transduction Particles
matrilin 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003833.2-1117s1c1
Sequence:CCGGCAGATTGTGGACTTCCTAGATCTCGAGATCTAGGAAGTCCACAATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003833.3-2070s21c1
Sequence:CCGGTCCGGCATTGAGCTGAGTTGGCTCGAGCCAACTCAGCTCAATGCCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003833.3-1281s21c1
Sequence:CCGGAGCGCTTCGTGAACCAGATTGCTCGAGCAATCTGGTTCACGAAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003833.3-285s21c1
Sequence:CCGGTGGATCTGGTGTTCGTGATTGCTCGAGCAATCACGAACACCAGATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003833.3-402s21c1
Sequence:CCGGGCGTTGGCGTGATCCAGTATTCTCGAGAATACTGGATCACGCCAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003833.3-864s21c1
Sequence:CCGGGTGAGCACCACTGCGTCAATTCTCGAGAATTGACGCAGTGGTGCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013592
MATN4 MISSION shRNA Bacterial Glycerol Stock
matrilin 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013592.2-334s1c1
Sequence:CCGGGTGATCCAGTATTCTAGTCAACTCGAGTTGACTAGAATACTGGATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013592.2-853s1c1
Sequence:CCGGGCACCAGATAACAAGAATTGTCTCGAGACAATTCTTGTTATCTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013592.2-842s1c1
Sequence:CCGGGCTACAAGCTAGCACCAGATACTCGAGTATCTGGTGCTAGCTTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013592.2-340s1c1
Sequence:CCGGCAGTATTCTAGTCAAGTGCAACTCGAGTTGCACTTGACTAGAATACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013592.2-1000s1c1
Sequence:CCGGGCCATTGACTACTGCAGCTTTCTCGAGAAAGCTGCAGTAGTCAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013592
MATN4 MISSION shRNA shRNA Plasmid DNA
matrilin 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013592.2-334s1c1
Sequence:CCGGGTGATCCAGTATTCTAGTCAACTCGAGTTGACTAGAATACTGGATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013592.2-853s1c1
Sequence:CCGGGCACCAGATAACAAGAATTGTCTCGAGACAATTCTTGTTATCTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013592.2-842s1c1
Sequence:CCGGGCTACAAGCTAGCACCAGATACTCGAGTATCTGGTGCTAGCTTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013592.2-340s1c1
Sequence:CCGGCAGTATTCTAGTCAAGTGCAACTCGAGTTGCACTTGACTAGAATACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013592.2-1000s1c1
Sequence:CCGGGCCATTGACTACTGCAGCTTTCTCGAGAAAGCTGCAGTAGTCAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013592
MATN4 MISSION shRNA Lentiviral Transduction Particles
matrilin 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013592.2-334s1c1
Sequence:CCGGGTGATCCAGTATTCTAGTCAACTCGAGTTGACTAGAATACTGGATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013592.2-853s1c1
Sequence:CCGGGCACCAGATAACAAGAATTGTCTCGAGACAATTCTTGTTATCTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013592.2-842s1c1
Sequence:CCGGGCTACAAGCTAGCACCAGATACTCGAGTATCTGGTGCTAGCTTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013592.2-340s1c1
Sequence:CCGGCAGTATTCTAGTCAAGTGCAACTCGAGTTGCACTTGACTAGAATACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013592.2-1000s1c1
Sequence:CCGGGCCATTGACTACTGCAGCTTTCTCGAGAAAGCTGCAGTAGTCAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)