EMAIL THIS PAGE TO A FRIEND

MATR3

matrin 3

202 Gene Product Result for
Synonyms: MPD2 VCPDM
UniProtKB ID: P43243, B7ZAV5, D3DQC3, Q9UHW0, Q9UQ27
Gene ID:
Human(9782) Summary: This locus encodes a nuclear matrix protein. Mutations at this locus have been associated with distal myopathy 2, which often includes vocal cord and pharyngeal weakness. Alternatively spliced transcript variants, including read-through transcripts with an upstream locus have been described. Related pseuodgenes have been defined on chr1 and chrX.[provided by RefSeq, Mar 2011]
Mouse(17184) matrin 3
Rat(29150) matrin 3
chicken(373948) matrin 3
cow(505129) matrin 3
Horse(100062181) matrin 3
dog(474700) matrin 3
sheep(101113235) matrin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010771 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010771 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010771 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018834 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018834 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018834 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018834 Rosetta Predictions human pricing
NM_199189 Rosetta Predictions human pricing
NM_019149 Rosetta Predictions rat pricing
NM_010771 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352277 predicted 1191
2 SASI_Hs01_00078168 predicted 1571
3 SASI_Hs01_00078169 predicted 2670
4 SASI_Hs02_00352278 predicted 1098
5 SASI_Hs01_00078171 predicted 2258
6 SASI_Hs01_00078172 predicted 1557
7 SASI_Hs01_00078173 predicted 1955
8 SASI_Hs01_00078174 predicted 2470
9 SASI_Hs01_00078175 predicted 535
10 SASI_Hs01_00078176 predicted 564
11 SASI_Hs01_00078170 predicted 2581
12 SASI_Hs01_00078177 predicted 905
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199189 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372648 predicted 1300
2 SASI_Hs01_00197406 predicted 1681
3 SASI_Hs01_00197407 predicted 2778
4 SASI_Hs02_00372649 predicted 1206
5 SASI_Hs01_00197409 predicted 2362
6 SASI_Hs01_00197410 predicted 1663
7 SASI_Hs01_00197411 predicted 2064
8 SASI_Hs01_00197412 predicted 2571
9 SASI_Hs01_00197413 predicted 649
10 SASI_Hs01_00197414 predicted 676
11 SASI_Hs01_00197408 predicted 2685
12 SASI_Hs01_00197415 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019149 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060696 predicted 1883
2 SASI_Rn01_00060697 predicted 2261
3 SASI_Rn01_00060698 predicted 2946
4 SASI_Rn01_00060699 predicted 3547
5 SASI_Rn01_00060700 predicted 3354
6 SASI_Rn01_00060702 predicted 1229
7 SASI_Rn01_00060704 predicted 1586
8 SASI_Rn02_00261920 predicted 2246
9 SASI_Rn02_00261921 predicted 2351
10 SASI_Rn02_00261922 predicted 3152
11 SASI_Rn01_00060695 predicted 2869
12 SASI_Rn01_00060701 predicted 3301
13 SASI_Rn01_00060703 predicted 1261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010771 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139437 predicted 1186
2 SASI_Mm01_00139438 predicted 1576
3 SASI_Mm01_00139439 predicted 1550
4 SASI_Mm01_00139440 predicted 2665
5 SASI_Mm01_00139441 predicted 2319
6 SASI_Mm01_00139442 predicted 533
7 SASI_Mm01_00139443 predicted 1666
8 SASI_Mm01_00139445 predicted 2464
9 SASI_Mm02_00319310 predicted 1951
10 SASI_Mm01_00139446 predicted 554
11 SASI_Mm01_00139444 predicted 915
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010771
VALIDATED
MATR3 MISSION shRNA Bacterial Glycerol Stock
matrin 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010771.6-732s21c1
Sequence:CCGGCCCAAATTCTTCTACAGCTTACTCGAGTAAGCTGTAGAAGAATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308814    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010771.6-3519s21c1
Sequence:CCGGCCGTTCTCTTTGACCAGTATTCTCGAGAATACTGGTCAAAGAGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010771.6-2781s21c1
Sequence:CCGGGCCTTCCTCATTATCAGAAATCTCGAGATTTCTGATAATGAGGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010771.6-2048s21c1
Sequence:CCGGCGGATTCCTAACAGAGGCATTCTCGAGAATGCCTCTGTTAGGAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010771.3-2666s1c1
Sequence:CCGGGCCTTCCTCATTATCAGAAATCTCGAGATTTCTGATAATGAGGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010771.3-3404s1c1
Sequence:CCGGCCGTTCTCTTTGACCAGTATTCTCGAGAATACTGGTCAAAGAGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010771.3-617s1c1
Sequence:CCGGCCCAAATTCTTCTACAGCTTACTCGAGTAAGCTGTAGAAGAATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010771.3-2667s1c1
Sequence:CCGGCCTTCCTCATTATCAGAAATTCTCGAGAATTTCTGATAATGAGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010771.3-1933s1c1
Sequence:CCGGCGGATTCCTAACAGAGGCATTCTCGAGAATGCCTCTGTTAGGAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010771
VALIDATED
MATR3 MISSION shRNA shRNA Plasmid DNA
matrin 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010771.6-732s21c1
Sequence:CCGGCCCAAATTCTTCTACAGCTTACTCGAGTAAGCTGTAGAAGAATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308814    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010771.6-3519s21c1
Sequence:CCGGCCGTTCTCTTTGACCAGTATTCTCGAGAATACTGGTCAAAGAGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010771.6-2781s21c1
Sequence:CCGGGCCTTCCTCATTATCAGAAATCTCGAGATTTCTGATAATGAGGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010771.6-2048s21c1
Sequence:CCGGCGGATTCCTAACAGAGGCATTCTCGAGAATGCCTCTGTTAGGAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010771.3-2666s1c1
Sequence:CCGGGCCTTCCTCATTATCAGAAATCTCGAGATTTCTGATAATGAGGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010771.3-3404s1c1
Sequence:CCGGCCGTTCTCTTTGACCAGTATTCTCGAGAATACTGGTCAAAGAGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010771.3-617s1c1
Sequence:CCGGCCCAAATTCTTCTACAGCTTACTCGAGTAAGCTGTAGAAGAATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010771.3-2667s1c1
Sequence:CCGGCCTTCCTCATTATCAGAAATTCTCGAGAATTTCTGATAATGAGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010771.3-1933s1c1
Sequence:CCGGCGGATTCCTAACAGAGGCATTCTCGAGAATGCCTCTGTTAGGAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010771
VALIDATED
MATR3 MISSION shRNA Lentiviral Transduction Particles
matrin 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010771.6-732s21c1
Sequence:CCGGCCCAAATTCTTCTACAGCTTACTCGAGTAAGCTGTAGAAGAATTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308814    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010771.6-3519s21c1
Sequence:CCGGCCGTTCTCTTTGACCAGTATTCTCGAGAATACTGGTCAAAGAGAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010771.6-2781s21c1
Sequence:CCGGGCCTTCCTCATTATCAGAAATCTCGAGATTTCTGATAATGAGGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010771.6-2048s21c1
Sequence:CCGGCGGATTCCTAACAGAGGCATTCTCGAGAATGCCTCTGTTAGGAATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010771.3-2666s1c1
Sequence:CCGGGCCTTCCTCATTATCAGAAATCTCGAGATTTCTGATAATGAGGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010771.3-3404s1c1
Sequence:CCGGCCGTTCTCTTTGACCAGTATTCTCGAGAATACTGGTCAAAGAGAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010771.3-617s1c1
Sequence:CCGGCCCAAATTCTTCTACAGCTTACTCGAGTAAGCTGTAGAAGAATTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010771.3-2667s1c1
Sequence:CCGGCCTTCCTCATTATCAGAAATTCTCGAGAATTTCTGATAATGAGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010771.3-1933s1c1
Sequence:CCGGCGGATTCCTAACAGAGGCATTCTCGAGAATGCCTCTGTTAGGAATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018834
VALIDATED
MATR3 MISSION shRNA Bacterial Glycerol Stock
matrin 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018834.4-1031s21c1
Sequence:CCGGGACCTCGCATAACTATCATAACTCGAGTTATGATAGTTATGCGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018834.4-863s21c1
Sequence:CCGGGCACTTTAGAAGAGATAGTTTCTCGAGAAACTATCTCTTCTAAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018834.4-2400s21c1
Sequence:CCGGCCATCAGATAAAGCTGTGAAACTCGAGTTTCACAGCTTTATCTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_018834.4-1658s21c1
Sequence:CCGGTCAGGCCGCAGTGGATTATTACTCGAGTAATAATCCACTGCGGCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_018834.4-3105s21c1
Sequence:CCGGTGACTTCCTAAGCTACTTAAGCTCGAGCTTAAGTAGCTTAGGAAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_018834.4-2349s1c1
Sequence:CCGGGAGACCGATCTTGCTAATTTACTCGAGTAAATTAGCAAGATCGGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018834.4-863s1c1
Sequence:CCGGGCACTTTAGAAGAGATAGTTTCTCGAGAAACTATCTCTTCTAAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018834.4-2400s1c1
Sequence:CCGGCCATCAGATAAAGCTGTGAAACTCGAGTTTCACAGCTTTATCTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018834.4-556s1c1
Sequence:CCGGCCCATAATTTGCAGTCTATATCTCGAGATATAGACTGCAAATTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: A3
TRC Version: 1 Clone ID:NM_018834.4-3530s1c1
Sequence:CCGGCCCGTTATCTTTGACCAGTATCTCGAGATACTGGTCAAAGATAACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018834
VALIDATED
MATR3 MISSION shRNA shRNA Plasmid DNA
matrin 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018834.4-1031s21c1
Sequence:CCGGGACCTCGCATAACTATCATAACTCGAGTTATGATAGTTATGCGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018834.4-863s21c1
Sequence:CCGGGCACTTTAGAAGAGATAGTTTCTCGAGAAACTATCTCTTCTAAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018834.4-2400s21c1
Sequence:CCGGCCATCAGATAAAGCTGTGAAACTCGAGTTTCACAGCTTTATCTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_018834.4-1658s21c1
Sequence:CCGGTCAGGCCGCAGTGGATTATTACTCGAGTAATAATCCACTGCGGCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_018834.4-3105s21c1
Sequence:CCGGTGACTTCCTAAGCTACTTAAGCTCGAGCTTAAGTAGCTTAGGAAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_018834.4-2349s1c1
Sequence:CCGGGAGACCGATCTTGCTAATTTACTCGAGTAAATTAGCAAGATCGGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018834.4-863s1c1
Sequence:CCGGGCACTTTAGAAGAGATAGTTTCTCGAGAAACTATCTCTTCTAAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018834.4-2400s1c1
Sequence:CCGGCCATCAGATAAAGCTGTGAAACTCGAGTTTCACAGCTTTATCTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018834.4-556s1c1
Sequence:CCGGCCCATAATTTGCAGTCTATATCTCGAGATATAGACTGCAAATTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: A3
TRC Version: 1 Clone ID:NM_018834.4-3530s1c1
Sequence:CCGGCCCGTTATCTTTGACCAGTATCTCGAGATACTGGTCAAAGATAACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018834
VALIDATED
MATR3 MISSION shRNA Lentiviral Transduction Particles
matrin 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018834.4-1031s21c1
Sequence:CCGGGACCTCGCATAACTATCATAACTCGAGTTATGATAGTTATGCGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018834.4-863s21c1
Sequence:CCGGGCACTTTAGAAGAGATAGTTTCTCGAGAAACTATCTCTTCTAAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018834.4-2400s21c1
Sequence:CCGGCCATCAGATAAAGCTGTGAAACTCGAGTTTCACAGCTTTATCTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_018834.4-1658s21c1
Sequence:CCGGTCAGGCCGCAGTGGATTATTACTCGAGTAATAATCCACTGCGGCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_018834.4-3105s21c1
Sequence:CCGGTGACTTCCTAAGCTACTTAAGCTCGAGCTTAAGTAGCTTAGGAAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_018834.4-2349s1c1
Sequence:CCGGGAGACCGATCTTGCTAATTTACTCGAGTAAATTAGCAAGATCGGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018834.4-863s1c1
Sequence:CCGGGCACTTTAGAAGAGATAGTTTCTCGAGAAACTATCTCTTCTAAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018834.4-2400s1c1
Sequence:CCGGCCATCAGATAAAGCTGTGAAACTCGAGTTTCACAGCTTTATCTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018834.4-556s1c1
Sequence:CCGGCCCATAATTTGCAGTCTATATCTCGAGATATAGACTGCAAATTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: A3
TRC Version: 1 Clone ID:NM_018834.4-3530s1c1
Sequence:CCGGCCCGTTATCTTTGACCAGTATCTCGAGATACTGGTCAAAGATAACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)