EMAIL THIS PAGE TO A FRIEND

MAU2

MAU2 sister chromatid cohesion factor

87 Gene Product Result for
Synonyms: KIAA0892 MAU2L SCC4 mau-2
UniProtKB ID: Q9Y6X3, Q66PT1, Q6P3S7, Q6ZTT2, Q9UFX8
Gene ID:
Mouse(74549) MAU2 chromatid cohesion factor homolog (C. elegans)
Rat(290668) Mau2 chromatid cohesion factor homolog (C. elegans)
chicken(428348) MAU2 chromatid cohesion factor homolog (C. elegans)
domestic cat(101099442) MAU2 chromatid cohesion factor homolog (C. elegans)
cow(528175) MAU2 chromatid cohesion factor homolog (C. elegans)
Horse(100069690) MAU2 chromatid cohesion factor homolog (C. elegans)
dog(484807) MAU2 chromatid cohesion factor homolog (C. elegans)
sheep(101105329) MAU2 chromatid cohesion factor homolog (C. elegans)
domestic guinea pig(100718568) MAU2 chromatid cohesion factor homolog (C. elegans)
Domestic Rabbit(100346683) MAU2 chromatid cohesion factor homolog (C. elegans)
naked mole-rat(101716510) MAU2 chromatid cohesion factor homolog (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015329 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015329 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015329 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028993 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028993 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028993 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU071271 MISSION® esiRNA esiRNA human KIAA0892 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015329 Rosetta Predictions human pricing
NM_001106077 Rosetta Predictions rat pricing
NM_028993 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015329 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347621 predicted 374
2 SASI_Hs02_00347622 predicted 1419
3 SASI_Hs02_00347623 predicted 327
4 SASI_Hs02_00347624 predicted 1324
5 SASI_Hs01_00035368 predicted 1970
6 SASI_Hs02_00347625 predicted 362
7 SASI_Hs02_00347626 predicted 1205
8 SASI_Hs01_00035372 predicted 1475
9 SASI_Hs02_00347627 predicted 394
10 SASI_Hs02_00347628 predicted 336
11 SASI_Hs01_00035365 predicted 431
12 SASI_Hs01_00035366 predicted 611
13 SASI_Hs01_00035367 predicted 852
14 SASI_Hs01_00035369 predicted 755
15 SASI_Hs01_00035370 predicted 748
16 SASI_Hs01_00035371 predicted 1506
17 SASI_Hs01_00035373 predicted 460
18 SASI_Hs01_00035374 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106077 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215402 predicted 1438
2 SASI_Rn02_00215403 predicted 367
3 SASI_Rn02_00215404 predicted 1496
4 SASI_Rn02_00215405 predicted 620
5 SASI_Rn02_00215406 predicted 1601
6 SASI_Rn02_00215407 predicted 1366
7 SASI_Rn02_00215408 predicted 465
8 SASI_Rn02_00215409 predicted 1850
9 SASI_Rn02_00215410 predicted 530
10 SASI_Rn02_00215411 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028993 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191393 predicted 1436
2 SASI_Mm01_00191394 predicted 362
3 SASI_Mm01_00191395 predicted 349
4 SASI_Mm01_00191396 predicted 1594
5 SASI_Mm01_00191397 predicted 1246
6 SASI_Mm01_00191398 predicted 1367
7 SASI_Mm01_00191399 predicted 399
8 SASI_Mm01_00191400 predicted 1511
9 SASI_Mm01_00191402 predicted 604
10 SASI_Mm02_00334722 predicted 470
11 SASI_Mm01_00191401 predicted 1983
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015329
VALIDATED
MAU2 MISSION shRNA Bacterial Glycerol Stock
MAU2 sister chromatid cohesion factor
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015329.3-1667s21c1
Sequence:CCGGCACTGCTGAGAGACCTGAATACTCGAGTATTCAGGTCTCTCAGCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015329.2-714s1c1
Sequence:CCGGCCACAGGGAGAGTAACAACATCTCGAGATGTTGTTACTCTCCCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015329.1-2208s1c1
Sequence:CCGGGAGCTTCCAAGTCCTGGGAATCTCGAGATTCCCAGGACTTGGAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141251    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015329.2-3004s1c1
Sequence:CCGGCGAGCTTTATGGAAGCCAAATCTCGAGATTTGGCTTCCATAAAGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015329.2-442s1c1
Sequence:CCGGGCGAGTGTGTATATACGGGAACTCGAGTTCCCGTATATACACACTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015329.2-3134s1c1
Sequence:CCGGGCCTCATAGCATCTCATTCAACTCGAGTTGAATGAGATGCTATGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015329.2-622s1c1
Sequence:CCGGGAAACTCTGAAGATGTCCAATCTCGAGATTGGACATCTTCAGAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015329.3-4643s21c1
Sequence:CCGGATAAGTACGTTTGGCATAATGCTCGAGCATTATGCCAAACGTACTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015329.3-1462s21c1
Sequence:CCGGTACAACGAGGCCAAGCGATTTCTCGAGAAATCGCTTGGCCTCGTTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015329.3-305s21c1
Sequence:CCGGTGGAGAAGGCGTGGTTGATATCTCGAGATATCAACCACGCCTTCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015329.3-337s21c1
Sequence:CCGGCCGCAGTTCGAAGATGTTAAACTCGAGTTTAACATCTTCGAACTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015329
VALIDATED
MAU2 MISSION shRNA shRNA Plasmid DNA
MAU2 sister chromatid cohesion factor
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015329.3-1667s21c1
Sequence:CCGGCACTGCTGAGAGACCTGAATACTCGAGTATTCAGGTCTCTCAGCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015329.2-714s1c1
Sequence:CCGGCCACAGGGAGAGTAACAACATCTCGAGATGTTGTTACTCTCCCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015329.1-2208s1c1
Sequence:CCGGGAGCTTCCAAGTCCTGGGAATCTCGAGATTCCCAGGACTTGGAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141251    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015329.2-3004s1c1
Sequence:CCGGCGAGCTTTATGGAAGCCAAATCTCGAGATTTGGCTTCCATAAAGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015329.2-442s1c1
Sequence:CCGGGCGAGTGTGTATATACGGGAACTCGAGTTCCCGTATATACACACTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015329.2-3134s1c1
Sequence:CCGGGCCTCATAGCATCTCATTCAACTCGAGTTGAATGAGATGCTATGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015329.2-622s1c1
Sequence:CCGGGAAACTCTGAAGATGTCCAATCTCGAGATTGGACATCTTCAGAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015329.3-4643s21c1
Sequence:CCGGATAAGTACGTTTGGCATAATGCTCGAGCATTATGCCAAACGTACTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015329.3-1462s21c1
Sequence:CCGGTACAACGAGGCCAAGCGATTTCTCGAGAAATCGCTTGGCCTCGTTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015329.3-305s21c1
Sequence:CCGGTGGAGAAGGCGTGGTTGATATCTCGAGATATCAACCACGCCTTCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015329.3-337s21c1
Sequence:CCGGCCGCAGTTCGAAGATGTTAAACTCGAGTTTAACATCTTCGAACTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015329
VALIDATED
MAU2 MISSION shRNA Lentiviral Transduction Particles
MAU2 sister chromatid cohesion factor
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015329.3-1667s21c1
Sequence:CCGGCACTGCTGAGAGACCTGAATACTCGAGTATTCAGGTCTCTCAGCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015329.2-714s1c1
Sequence:CCGGCCACAGGGAGAGTAACAACATCTCGAGATGTTGTTACTCTCCCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015329.1-2208s1c1
Sequence:CCGGGAGCTTCCAAGTCCTGGGAATCTCGAGATTCCCAGGACTTGGAAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141251    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015329.2-3004s1c1
Sequence:CCGGCGAGCTTTATGGAAGCCAAATCTCGAGATTTGGCTTCCATAAAGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015329.2-442s1c1
Sequence:CCGGGCGAGTGTGTATATACGGGAACTCGAGTTCCCGTATATACACACTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015329.2-3134s1c1
Sequence:CCGGGCCTCATAGCATCTCATTCAACTCGAGTTGAATGAGATGCTATGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015329.2-622s1c1
Sequence:CCGGGAAACTCTGAAGATGTCCAATCTCGAGATTGGACATCTTCAGAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015329.3-4643s21c1
Sequence:CCGGATAAGTACGTTTGGCATAATGCTCGAGCATTATGCCAAACGTACTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015329.3-1462s21c1
Sequence:CCGGTACAACGAGGCCAAGCGATTTCTCGAGAAATCGCTTGGCCTCGTTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015329.3-305s21c1
Sequence:CCGGTGGAGAAGGCGTGGTTGATATCTCGAGATATCAACCACGCCTTCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015329.3-337s21c1
Sequence:CCGGCCGCAGTTCGAAGATGTTAAACTCGAGTTTAACATCTTCGAACTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028993
VALIDATED
MAU2 MISSION shRNA Bacterial Glycerol Stock
MAU2 sister chromatid cohesion factor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000190564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028993.2-2504s1c1
Sequence:CCGGGCAGCTATTTAGCTTTCCCATCTCGAGATGGGAAAGCTAAATAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028993.3-2294s21c1
Sequence:CCGGCCTGGAAGTCAGACTCTTAATCTCGAGATTAAGAGTCTGACTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028993.2-2295s1c1
Sequence:CCGGCCTGGAAGTCAGACTCTTAATCTCGAGATTAAGAGTCTGACTTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028993.2-365s1c1
Sequence:CCGGCCCACAGTTTGAAGATGTTAACTCGAGTTAACATCTTCAAACTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028993.3-1693s21c1
Sequence:CCGGCCTCCTGAGAGACCTAAACAACTCGAGTTGTTTAGGTCTCTCAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028993.3-196s21c1
Sequence:CCGGGATCCGCTTGTGCGTTCATTGCTCGAGCAATGAACGCACAAGCGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028993.3-364s21c1
Sequence:CCGGCCCACAGTTTGAAGATGTTAACTCGAGTTAACATCTTCAAACTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028993.3-1238s21c1
Sequence:CCGGTCCGTGAACTGCATGGATAATCTCGAGATTATCCATGCAGTTCACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028993.2-1694s1c1
Sequence:CCGGCCTCCTGAGAGACCTAAACAACTCGAGTTGTTTAGGTCTCTCAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028993
VALIDATED
MAU2 MISSION shRNA shRNA Plasmid DNA
MAU2 sister chromatid cohesion factor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000190564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028993.2-2504s1c1
Sequence:CCGGGCAGCTATTTAGCTTTCCCATCTCGAGATGGGAAAGCTAAATAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028993.3-2294s21c1
Sequence:CCGGCCTGGAAGTCAGACTCTTAATCTCGAGATTAAGAGTCTGACTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028993.2-2295s1c1
Sequence:CCGGCCTGGAAGTCAGACTCTTAATCTCGAGATTAAGAGTCTGACTTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028993.2-365s1c1
Sequence:CCGGCCCACAGTTTGAAGATGTTAACTCGAGTTAACATCTTCAAACTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028993.3-1693s21c1
Sequence:CCGGCCTCCTGAGAGACCTAAACAACTCGAGTTGTTTAGGTCTCTCAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028993.3-196s21c1
Sequence:CCGGGATCCGCTTGTGCGTTCATTGCTCGAGCAATGAACGCACAAGCGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028993.3-364s21c1
Sequence:CCGGCCCACAGTTTGAAGATGTTAACTCGAGTTAACATCTTCAAACTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028993.3-1238s21c1
Sequence:CCGGTCCGTGAACTGCATGGATAATCTCGAGATTATCCATGCAGTTCACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028993.2-1694s1c1
Sequence:CCGGCCTCCTGAGAGACCTAAACAACTCGAGTTGTTTAGGTCTCTCAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028993
VALIDATED
MAU2 MISSION shRNA Lentiviral Transduction Particles
MAU2 sister chromatid cohesion factor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000190564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028993.2-2504s1c1
Sequence:CCGGGCAGCTATTTAGCTTTCCCATCTCGAGATGGGAAAGCTAAATAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028993.3-2294s21c1
Sequence:CCGGCCTGGAAGTCAGACTCTTAATCTCGAGATTAAGAGTCTGACTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028993.2-2295s1c1
Sequence:CCGGCCTGGAAGTCAGACTCTTAATCTCGAGATTAAGAGTCTGACTTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028993.2-365s1c1
Sequence:CCGGCCCACAGTTTGAAGATGTTAACTCGAGTTAACATCTTCAAACTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028993.3-1693s21c1
Sequence:CCGGCCTCCTGAGAGACCTAAACAACTCGAGTTGTTTAGGTCTCTCAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028993.3-196s21c1
Sequence:CCGGGATCCGCTTGTGCGTTCATTGCTCGAGCAATGAACGCACAAGCGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028993.3-364s21c1
Sequence:CCGGCCCACAGTTTGAAGATGTTAACTCGAGTTAACATCTTCAAACTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028993.3-1238s21c1
Sequence:CCGGTCCGTGAACTGCATGGATAATCTCGAGATTATCCATGCAGTTCACGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028993.2-1694s1c1
Sequence:CCGGCCTCCTGAGAGACCTAAACAACTCGAGTTGTTTAGGTCTCTCAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)