EMAIL THIS PAGE TO A FRIEND

MAVS

mitochondrial antiviral signaling protein

62 Gene Product Result for
Synonyms: CARDIF IPS-1 IPS1 VISA
Gene ID:
Human(57506) Summary: This gene encodes an intermediary protein necessary in the virus-triggered beta interferon signaling pathways. It is required for activation of transcription factors which regulate expression of beta interferon and contributes to antiviral immunity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Mouse(228607) mitochondrial antiviral signaling protein
Rat(311430) mitochondrial antiviral signaling protein
Zebrafish(562867) mitochondrial antiviral signaling protein
cow(618508) mitochondrial antiviral signaling protein
domestic cat(101085709) mitochondrial antiviral signaling protein
dog(485789) mitochondrial antiviral signaling protein
chicken(422936) mitochondrial antiviral signaling protein
naked mole-rat(101703437) mitochondrial antiviral signaling protein
domestic guinea pig(100712673) mitochondrial antiviral signaling protein
sheep(101119838) mitochondrial antiviral signaling protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA049850 Anti-MAVS antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
HPA053524 Anti-MAVS antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry pricing
PRS4053 Anti-VISA (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2102679 Anti-VISA (ab1) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2900292 Anti-VISA (AB1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
immunohistochemistry, western blot pricing
PRS4055 Anti-VISA (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2102680 Anti-VISA (ab2) antibody produced in rabbit affinity isolated antibody, lyophilized powder bovine, human, mouse
western blot pricing
SAB2900400 Anti-VISA (AB2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
immunohistochemistry, western blot pricing
SAB1400655 Anti-VISA antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2108253 Anti-VISA antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020746 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020746 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020746 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144888 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144888 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144888 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU056071 MISSION® esiRNA esiRNA targeting mouse D430028G21Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020746 Rosetta Predictions human pricing
NM_001005556 Rosetta Predictions rat pricing
NM_144888 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020746 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128708 predicted 1715
2 SASI_Hs01_00128711 predicted 968
3 SASI_Hs01_00128712 predicted 2123
4 SASI_Hs01_00128713 predicted 950
5 SASI_Hs01_00128714 predicted 1150
6 SASI_Hs01_00128715 predicted 1489
7 SASI_Hs01_00128716 predicted 1344
8 SASI_Hs02_00353853 predicted 1503
9 SASI_Hs02_00353854 predicted 1887
10 SASI_Hs02_00353855 predicted 2018
11 SASI_Hs01_00128709 predicted 303
12 SASI_Hs01_00128710 predicted 2182
13 SASI_Hs01_00128717 predicted 2212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005556 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100421 predicted 1804
2 SASI_Rn01_00100422 predicted 1239
3 SASI_Rn01_00100423 predicted 1754
4 SASI_Rn02_00198418 predicted 1041
5 SASI_Rn01_00100424 predicted 1596
6 SASI_Rn01_00100425 predicted 699
7 SASI_Rn01_00100426 predicted 1355
8 SASI_Rn01_00100427 predicted 326
9 SASI_Rn01_00100428 predicted 1165
10 SASI_Rn01_00100429 predicted 1815
11 SASI_Rn01_00100430 predicted 1247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144888 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042222 predicted 913
2 SASI_Mm01_00042223 predicted 1732
3 SASI_Mm01_00042224 predicted 1571
4 SASI_Mm01_00042225 predicted 295
5 SASI_Mm01_00042226 predicted 1573
6 SASI_Mm01_00042227 predicted 602
7 SASI_Mm01_00042228 predicted 307
8 SASI_Mm01_00042229 predicted 851
9 SASI_Mm01_00042230 predicted 1826
10 SASI_Mm02_00340339 predicted 635
11 SASI_Mm01_00042231 predicted 611
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020746
VALIDATED
MAVS MISSION shRNA Bacterial Glycerol Stock
mitochondrial antiviral signaling protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236030    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_020746.3-2994s21c1
Sequence:CCGGTTTACCAAGGGTTGGATATATCTCGAGATATATCCAACCCTTGGTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020746.3-196s21c1
Sequence:CCGGTAAGTATATCTGCCGCAATTTCTCGAGAAATTGCGGCAGATATACTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_020746.3-231s21c1
Sequence:CCGGATGTGGATGTTGTAGAGATTCCTCGAGGAATCTCTACAACATCCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020746.1-164s1c1
Sequence:CCGGCTGCCGCAATTTCAGCAATTTCTCGAGAAATTGCTGAAATTGCGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020746.1-1100s1c1
Sequence:CCGGCAAGTTGCCAACTAGCTCAAACTCGAGTTTGAGCTAGTTGGCAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146651    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020746.1-3295s1c1
Sequence:CCGGCCTTACTTTATCTTGTGCCTTCTCGAGAAGGCACAAGATAAAGTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020746.1-296s1c1
Sequence:CCGGGCATCTCTTCAATACCCTTCACTCGAGTGAAGGGTATTGAAGAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149112    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020746.1-2949s1c1
Sequence:CCGGGCATTTACCAAGGGTTGGATACTCGAGTATCCAACCCTTGGTAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_020746.3-1532s21c1
Sequence:CCGGCCAGAGGAGAATGAGTATAAGCTCGAGCTTATACTCATTCTCCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020746
VALIDATED
MAVS MISSION shRNA shRNA Plasmid DNA
mitochondrial antiviral signaling protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236030    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_020746.3-2994s21c1
Sequence:CCGGTTTACCAAGGGTTGGATATATCTCGAGATATATCCAACCCTTGGTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020746.3-196s21c1
Sequence:CCGGTAAGTATATCTGCCGCAATTTCTCGAGAAATTGCGGCAGATATACTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_020746.3-231s21c1
Sequence:CCGGATGTGGATGTTGTAGAGATTCCTCGAGGAATCTCTACAACATCCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020746.1-164s1c1
Sequence:CCGGCTGCCGCAATTTCAGCAATTTCTCGAGAAATTGCTGAAATTGCGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020746.1-1100s1c1
Sequence:CCGGCAAGTTGCCAACTAGCTCAAACTCGAGTTTGAGCTAGTTGGCAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146651    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020746.1-3295s1c1
Sequence:CCGGCCTTACTTTATCTTGTGCCTTCTCGAGAAGGCACAAGATAAAGTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020746.1-296s1c1
Sequence:CCGGGCATCTCTTCAATACCCTTCACTCGAGTGAAGGGTATTGAAGAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149112    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020746.1-2949s1c1
Sequence:CCGGGCATTTACCAAGGGTTGGATACTCGAGTATCCAACCCTTGGTAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_020746.3-1532s21c1
Sequence:CCGGCCAGAGGAGAATGAGTATAAGCTCGAGCTTATACTCATTCTCCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020746
VALIDATED
MAVS MISSION shRNA Lentiviral Transduction Particles
mitochondrial antiviral signaling protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236030    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_020746.3-2994s21c1
Sequence:CCGGTTTACCAAGGGTTGGATATATCTCGAGATATATCCAACCCTTGGTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020746.3-196s21c1
Sequence:CCGGTAAGTATATCTGCCGCAATTTCTCGAGAAATTGCGGCAGATATACTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_020746.3-231s21c1
Sequence:CCGGATGTGGATGTTGTAGAGATTCCTCGAGGAATCTCTACAACATCCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020746.1-164s1c1
Sequence:CCGGCTGCCGCAATTTCAGCAATTTCTCGAGAAATTGCTGAAATTGCGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020746.1-1100s1c1
Sequence:CCGGCAAGTTGCCAACTAGCTCAAACTCGAGTTTGAGCTAGTTGGCAACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146651    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020746.1-3295s1c1
Sequence:CCGGCCTTACTTTATCTTGTGCCTTCTCGAGAAGGCACAAGATAAAGTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020746.1-296s1c1
Sequence:CCGGGCATCTCTTCAATACCCTTCACTCGAGTGAAGGGTATTGAAGAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149112    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020746.1-2949s1c1
Sequence:CCGGGCATTTACCAAGGGTTGGATACTCGAGTATCCAACCCTTGGTAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_020746.3-1532s21c1
Sequence:CCGGCCAGAGGAGAATGAGTATAAGCTCGAGCTTATACTCATTCTCCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144888
MAVS MISSION shRNA Bacterial Glycerol Stock
mitochondrial antiviral signaling protein
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144888.1-797s1c1
Sequence:CCGGGCTCTTTGATACCCTCTCCTACTCGAGTAGGAGAGGGTATCAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124769    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144888.1-1858s1c1
Sequence:CCGGGCTGAGTCAGAGAAACTTAAACTCGAGTTTAAGTTTCTCTGACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144888.1-1726s21c1
Sequence:CCGGAGTGCACTCTTGGCTGTATTCCTCGAGGAATACAGCCAAGAGTGCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144888.1-313s1c1
Sequence:CCGGCGAGACAACCACAGCAAGTTTCTCGAGAAACTTGCTGTGGTTGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144888.1-1616s1c1
Sequence:CCGGCCAGTGCTGATCTATTAGGAACTCGAGTTCCTAATAGATCAGCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144888.1-1403s1c1
Sequence:CCGGGCAACCAGACTGGACCAAATACTCGAGTATTTGGTCCAGTCTGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144888
MAVS MISSION shRNA shRNA Plasmid DNA
mitochondrial antiviral signaling protein
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144888.1-797s1c1
Sequence:CCGGGCTCTTTGATACCCTCTCCTACTCGAGTAGGAGAGGGTATCAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124769    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144888.1-1858s1c1
Sequence:CCGGGCTGAGTCAGAGAAACTTAAACTCGAGTTTAAGTTTCTCTGACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144888.1-1726s21c1
Sequence:CCGGAGTGCACTCTTGGCTGTATTCCTCGAGGAATACAGCCAAGAGTGCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144888.1-313s1c1
Sequence:CCGGCGAGACAACCACAGCAAGTTTCTCGAGAAACTTGCTGTGGTTGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144888.1-1616s1c1
Sequence:CCGGCCAGTGCTGATCTATTAGGAACTCGAGTTCCTAATAGATCAGCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144888.1-1403s1c1
Sequence:CCGGGCAACCAGACTGGACCAAATACTCGAGTATTTGGTCCAGTCTGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144888
MAVS MISSION shRNA Lentiviral Transduction Particles
mitochondrial antiviral signaling protein
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144888.1-797s1c1
Sequence:CCGGGCTCTTTGATACCCTCTCCTACTCGAGTAGGAGAGGGTATCAAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124769    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144888.1-1858s1c1
Sequence:CCGGGCTGAGTCAGAGAAACTTAAACTCGAGTTTAAGTTTCTCTGACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144888.1-1726s21c1
Sequence:CCGGAGTGCACTCTTGGCTGTATTCCTCGAGGAATACAGCCAAGAGTGCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144888.1-313s1c1
Sequence:CCGGCGAGACAACCACAGCAAGTTTCTCGAGAAACTTGCTGTGGTTGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144888.1-1616s1c1
Sequence:CCGGCCAGTGCTGATCTATTAGGAACTCGAGTTCCTAATAGATCAGCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144888.1-1403s1c1
Sequence:CCGGGCAACCAGACTGGACCAAATACTCGAGTATTTGGTCCAGTCTGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)