EMAIL THIS PAGE TO A FRIEND

MAX

MYC associated factor X

222 Gene Product Result for
Synonyms: bHLHd4
Gene ID:
Human(4149) Summary: The protein encoded by this gene is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell proliferation, differentiation and apoptosis. The homodimers and heterodimers compete for a common DNA target site (the E box) and rearrangement among these dimer forms provides a complex system of transcriptional regulation. Mutations of this gene have been reported to be associated with hereditary pheochromocytoma. A pseudogene of this gene is located on the long arm of chromosome 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Mouse(17187) Max protein
Rat(60661) MYC associated factor X
domestic guinea pig(100718960) MYC associated factor X
naked mole-rat(101699034) MYC associated factor X
Zebrafish(30467) myc-associated factor X
chicken(100858676) MYC associated factor X
cow(540616) MYC associated factor X
domestic cat(493947) MYC associated factor X
dog(609969) MYC associated factor X
fruit fly(40095) CG9648 gene product from transcript CG9648-RA
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008558 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008558 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008558 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002382 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002382 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002382 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002382 Rosetta Predictions human pricing
NM_145112 Rosetta Predictions human pricing
NM_145113 Rosetta Predictions human pricing
NM_145114 Rosetta Predictions human pricing
NM_145116 Rosetta Predictions human pricing
NM_197957 Rosetta Predictions human pricing
NM_022210 Rosetta Predictions rat pricing
NM_008558 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002382 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011941 predicted 398
2 SASI_Hs02_00333726 predicted 382
3 SASI_Hs01_00011942 predicted 431
4 SASI_Hs02_00333727 predicted 737
5 SASI_Hs01_00011944 predicted 1064
6 SASI_Hs01_00011945 predicted 1108
7 SASI_Hs01_00011947 predicted 1055
8 SASI_Hs01_00011948 predicted 201
9 SASI_Hs01_00011950 predicted 548
10 SASI_Hs02_00333728 predicted 1080
11 SASI_Hs01_00011943 predicted 276
12 SASI_Hs01_00011946 predicted 244
13 SASI_Hs01_00011949 predicted 232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170413 predicted 378
2 SASI_Hs02_00364985 predicted 352
3 SASI_Hs01_00170415 predicted 408
4 SASI_Hs02_00364986 predicted 707
5 SASI_Hs01_00170417 predicted 1037
6 SASI_Hs01_00170418 predicted 1082
7 SASI_Hs01_00170419 predicted 1029
8 SASI_Hs01_00170421 predicted 521
9 SASI_Hs02_00364987 predicted 1050
10 SASI_Hs02_00364988 predicted 165
11 SASI_Hs01_00170414 predicted 215
12 SASI_Hs01_00170416 predicted 251
13 SASI_Hs01_00170420 predicted 215
14 SASI_Hs01_00170422 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209326 predicted 406
2 SASI_Hs02_00364989 predicted 379
3 SASI_Hs02_00364990 predicted 831
4 SASI_Hs01_00209329 predicted 470
5 SASI_Hs01_00209330 predicted 204
6 SASI_Hs01_00209332 predicted 518
7 SASI_Hs01_00209333 predicted 656
8 SASI_Hs01_00209335 predicted 518
9 SASI_Hs02_00364991 predicted 173
10 SASI_Hs02_00364992 predicted 816
11 SASI_Hs01_00209327 predicted 273
12 SASI_Hs01_00209328 predicted 243
13 SASI_Hs01_00209331 predicted 233
14 SASI_Hs01_00209334 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145114 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053520 predicted 365
2 SASI_Hs01_00053521 predicted 613
3 SASI_Hs01_00053522 predicted 331
4 SASI_Hs01_00053523 predicted 409
5 SASI_Hs01_00053524 predicted 535
6 SASI_Hs01_00053525 predicted 531
7 SASI_Hs01_00053526 predicted 374
8 SASI_Hs02_00364993 predicted 648
9 SASI_Hs02_00364994 predicted 501
10 SASI_Hs02_00364995 predicted 371
11 SASI_Hs01_00053517 predicted 496
12 SASI_Hs01_00053518 predicted 526
13 SASI_Hs01_00053519 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145116 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152319 predicted 347
2 SASI_Hs01_00152320 predicted 343
3 SASI_Hs01_00152321 predicted 335
4 SASI_Hs01_00152322 predicted 333
5 SASI_Hs01_00152323 predicted 343
6 SASI_Hs01_00152324 predicted 334
7 SASI_Hs01_00152325 predicted 397
8 SASI_Hs02_00364997 predicted 373
9 SASI_Hs01_00152328 predicted 198
10 SASI_Hs02_00364998 predicted 422
11 SASI_Hs01_00152326 predicted 277
12 SASI_Hs01_00152327 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195043 predicted 362
2 SASI_Hs01_00195045 predicted 335
3 SASI_Hs01_00195046 predicted 235
4 SASI_Hs01_00195047 predicted 197
5 SASI_Hs02_00371558 predicted 232
6 SASI_Hs02_00371559 predicted 233
7 SASI_Hs02_00371560 predicted 340
8 SASI_Hs01_00195050 predicted 174
9 SASI_Hs02_00371561 predicted 174
10 SASI_Hs02_00371562 predicted 293
11 SASI_Hs01_00195044 predicted 279
12 SASI_Hs01_00195048 predicted 241
13 SASI_Hs01_00195049 predicted 229
14 SASI_Hs01_00195051 predicted 332
15 SASI_Hs01_00195052 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022210 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116919 predicted 238
2 SASI_Rn01_00116920 predicted 210
3 SASI_Rn01_00116921 predicted 195
4 SASI_Rn01_00116922 predicted 234
5 SASI_Rn01_00116923 predicted 230
6 SASI_Rn01_00116924 predicted 196
7 SASI_Rn01_00116925 predicted 246
8 SASI_Rn01_00116926 predicted 232
9 SASI_Rn01_00116927 predicted 255
10 SASI_Rn01_00116928 predicted 200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008558 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314149 predicted 460
2 SASI_Mm02_00314150 predicted 355
3 SASI_Mm01_00057592 predicted 722
4 SASI_Mm01_00057593 predicted 1041
5 SASI_Mm01_00057594 predicted 1029
6 SASI_Mm02_00314151 predicted 355
7 SASI_Mm01_00057596 predicted 1112
8 SASI_Mm02_00314152 predicted 426
9 SASI_Mm02_00314153 predicted 359
10 SASI_Mm01_00057600 predicted 545
11 SASI_Mm01_00057591 predicted 588
12 SASI_Mm01_00057595 predicted 693
13 SASI_Mm01_00057597 predicted 715
14 SASI_Mm01_00057598 predicted 327
15 SASI_Mm01_00057599 predicted 748
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008558
VALIDATED
MAX MISSION shRNA Bacterial Glycerol Stock
MYC associated factor X
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008558.1-342s1c1
Sequence:CCGGCCCAAATCCTAGACAAAGCAACTCGAGTTGCTTTGTCTAGGATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008558.2-547s21c1
Sequence:CCGGTGCCCAACTGCAGACCAACTACTCGAGTAGTTGGTCTGCAGTTGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008558.1-236s1c1
Sequence:CCGGGCTCACCATAATGCACTGGAACTCGAGTTCCAGTGCATTATGGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008558.1-359s1c1
Sequence:CCGGGCAACAGAGTATATCCAGTATCTCGAGATACTGGATATACTCTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008558.1-462s1c1
Sequence:CCGGCACTGGAGAAGGCAAGATCAACTCGAGTTGATCTTGCCTTCTCCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008558.1-211s1c1
Sequence:CCGGGTTTCAATCTGCGGCTGACAACTCGAGTTGTCAGCCGCAGATTGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374152    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008558.2-786s21c1
Sequence:CCGGACCATTGAGAAGACTCTTTATCTCGAGATAAAGAGTCTTCTCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008558.2-405s21c1
Sequence:CCGGCCCAAATCCTAGACAAAGCAACTCGAGTTGCTTTGTCTAGGATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008558.2-325s21c1
Sequence:CCGGACGTAGGGACCACATCAAAGACTCGAGTCTTTGATGTGGTCCCTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008558.2-1177s21c1
Sequence:CCGGCCCTCCTTTGTAAGGATTATTCTCGAGAATAATCCTTACAAAGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008558.2-422s21c1
Sequence:CCGGGCAACAGAGTATATCCAGTATCTCGAGATACTGGATATACTCTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008558
VALIDATED
MAX MISSION shRNA shRNA Plasmid DNA
MYC associated factor X
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008558.1-342s1c1
Sequence:CCGGCCCAAATCCTAGACAAAGCAACTCGAGTTGCTTTGTCTAGGATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008558.2-547s21c1
Sequence:CCGGTGCCCAACTGCAGACCAACTACTCGAGTAGTTGGTCTGCAGTTGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008558.1-236s1c1
Sequence:CCGGGCTCACCATAATGCACTGGAACTCGAGTTCCAGTGCATTATGGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008558.1-359s1c1
Sequence:CCGGGCAACAGAGTATATCCAGTATCTCGAGATACTGGATATACTCTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008558.1-462s1c1
Sequence:CCGGCACTGGAGAAGGCAAGATCAACTCGAGTTGATCTTGCCTTCTCCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008558.1-211s1c1
Sequence:CCGGGTTTCAATCTGCGGCTGACAACTCGAGTTGTCAGCCGCAGATTGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374152    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008558.2-786s21c1
Sequence:CCGGACCATTGAGAAGACTCTTTATCTCGAGATAAAGAGTCTTCTCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008558.2-405s21c1
Sequence:CCGGCCCAAATCCTAGACAAAGCAACTCGAGTTGCTTTGTCTAGGATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008558.2-325s21c1
Sequence:CCGGACGTAGGGACCACATCAAAGACTCGAGTCTTTGATGTGGTCCCTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008558.2-1177s21c1
Sequence:CCGGCCCTCCTTTGTAAGGATTATTCTCGAGAATAATCCTTACAAAGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008558.2-422s21c1
Sequence:CCGGGCAACAGAGTATATCCAGTATCTCGAGATACTGGATATACTCTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008558
VALIDATED
MAX MISSION shRNA Lentiviral Transduction Particles
MYC associated factor X
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008558.1-342s1c1
Sequence:CCGGCCCAAATCCTAGACAAAGCAACTCGAGTTGCTTTGTCTAGGATTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008558.2-547s21c1
Sequence:CCGGTGCCCAACTGCAGACCAACTACTCGAGTAGTTGGTCTGCAGTTGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008558.1-236s1c1
Sequence:CCGGGCTCACCATAATGCACTGGAACTCGAGTTCCAGTGCATTATGGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008558.1-359s1c1
Sequence:CCGGGCAACAGAGTATATCCAGTATCTCGAGATACTGGATATACTCTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008558.1-462s1c1
Sequence:CCGGCACTGGAGAAGGCAAGATCAACTCGAGTTGATCTTGCCTTCTCCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008558.1-211s1c1
Sequence:CCGGGTTTCAATCTGCGGCTGACAACTCGAGTTGTCAGCCGCAGATTGAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374152    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008558.2-786s21c1
Sequence:CCGGACCATTGAGAAGACTCTTTATCTCGAGATAAAGAGTCTTCTCAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008558.2-405s21c1
Sequence:CCGGCCCAAATCCTAGACAAAGCAACTCGAGTTGCTTTGTCTAGGATTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008558.2-325s21c1
Sequence:CCGGACGTAGGGACCACATCAAAGACTCGAGTCTTTGATGTGGTCCCTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008558.2-1177s21c1
Sequence:CCGGCCCTCCTTTGTAAGGATTATTCTCGAGAATAATCCTTACAAAGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008558.2-422s21c1
Sequence:CCGGGCAACAGAGTATATCCAGTATCTCGAGATACTGGATATACTCTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002382
VALIDATED
MAX MISSION shRNA Bacterial Glycerol Stock
MYC associated factor X
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002382.3-246s1c1
Sequence:CCGGGCTCATCATAATGCACTGGAACTCGAGTTCCAGTGCATTATGATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002382.3-279s1c1
Sequence:CCGGGACCACATCAAAGACAGCTTTCTCGAGAAAGCTGTCTTTGATGTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002382.3-1593s1c1
Sequence:CCGGCCCGTGTGTATTTCTAAGAAACTCGAGTTTCTTAGAAATACACACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002382.3-370s1c1
Sequence:CCGGCCACAGAATATATCCAGTATACTCGAGTATACTGGATATATTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002382.3-205s21c1
Sequence:CCGGACGAAGAGCAACCGAGGTTTCCTCGAGGAAACCTCGGTTGCTCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002382.3-1510s21c1
Sequence:CCGGCTGAGTGAATTGTACCTATTTCTCGAGAAATAGGTACAATTCACTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002382.3-406s21c1
Sequence:CCGGACACACACCAGCAAGATATTGCTCGAGCAATATCTTGCTGGTGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002382.3-370s21c1
Sequence:CCGGCCACAGAATATATCCAGTATACTCGAGTATACTGGATATATTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002382.3-237s21c1
Sequence:CCGGGACAAACGGGCTCATCATAATCTCGAGATTATGATGAGCCCGTTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002382
VALIDATED
MAX MISSION shRNA shRNA Plasmid DNA
MYC associated factor X
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002382.3-246s1c1
Sequence:CCGGGCTCATCATAATGCACTGGAACTCGAGTTCCAGTGCATTATGATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002382.3-279s1c1
Sequence:CCGGGACCACATCAAAGACAGCTTTCTCGAGAAAGCTGTCTTTGATGTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002382.3-1593s1c1
Sequence:CCGGCCCGTGTGTATTTCTAAGAAACTCGAGTTTCTTAGAAATACACACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002382.3-370s1c1
Sequence:CCGGCCACAGAATATATCCAGTATACTCGAGTATACTGGATATATTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002382.3-205s21c1
Sequence:CCGGACGAAGAGCAACCGAGGTTTCCTCGAGGAAACCTCGGTTGCTCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002382.3-1510s21c1
Sequence:CCGGCTGAGTGAATTGTACCTATTTCTCGAGAAATAGGTACAATTCACTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002382.3-406s21c1
Sequence:CCGGACACACACCAGCAAGATATTGCTCGAGCAATATCTTGCTGGTGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002382.3-370s21c1
Sequence:CCGGCCACAGAATATATCCAGTATACTCGAGTATACTGGATATATTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002382.3-237s21c1
Sequence:CCGGGACAAACGGGCTCATCATAATCTCGAGATTATGATGAGCCCGTTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002382
VALIDATED
MAX MISSION shRNA Lentiviral Transduction Particles
MYC associated factor X
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002382.3-246s1c1
Sequence:CCGGGCTCATCATAATGCACTGGAACTCGAGTTCCAGTGCATTATGATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002382.3-279s1c1
Sequence:CCGGGACCACATCAAAGACAGCTTTCTCGAGAAAGCTGTCTTTGATGTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002382.3-1593s1c1
Sequence:CCGGCCCGTGTGTATTTCTAAGAAACTCGAGTTTCTTAGAAATACACACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002382.3-370s1c1
Sequence:CCGGCCACAGAATATATCCAGTATACTCGAGTATACTGGATATATTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002382.3-205s21c1
Sequence:CCGGACGAAGAGCAACCGAGGTTTCCTCGAGGAAACCTCGGTTGCTCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002382.3-1510s21c1
Sequence:CCGGCTGAGTGAATTGTACCTATTTCTCGAGAAATAGGTACAATTCACTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002382.3-406s21c1
Sequence:CCGGACACACACCAGCAAGATATTGCTCGAGCAATATCTTGCTGGTGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002382.3-370s21c1
Sequence:CCGGCCACAGAATATATCCAGTATACTCGAGTATACTGGATATATTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002382.3-237s21c1
Sequence:CCGGGACAAACGGGCTCATCATAATCTCGAGATTATGATGAGCCCGTTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)