EMAIL THIS PAGE TO A FRIEND

MB21D1

Mab-21 domain containing 1

55 Gene Product Result for
Synonyms: C6orf150 cGAS h-cGAS
Gene ID:
Mouse(214763) Mab-21 domain containing 1
Rat(682147) Mab-21 domain containing 1
chicken(421864) Mab-21 domain containing 1
dog(611033) Mab-21 domain containing 1
domestic cat(101098056) Mab-21 domain containing 1
cow(782472) Mab-21 domain containing 1
domestic guinea pig(100713978) Mab-21 domain containing 1
naked mole-rat(101717623) Mab-21 domain containing 1
sheep(101117253) Mab-21 domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138441 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138441 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138441 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173386 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173386 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173386 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138441 Rosetta Predictions human pricing
XM_001060106 Rosetta Predictions rat pricing
NM_173386 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197466 predicted 1049
2 SASI_Hs01_00197467 predicted 776
3 SASI_Hs01_00197468 predicted 1133
4 SASI_Hs01_00197470 predicted 1011
5 SASI_Hs01_00197472 predicted 789
6 SASI_Hs01_00197473 predicted 800
7 SASI_Hs02_00363602 predicted 796
8 SASI_Hs02_00363603 predicted 791
9 SASI_Hs01_00197474 predicted 1184
10 SASI_Hs02_00363604 predicted 1187
11 SASI_Hs01_00197469 predicted 829
12 SASI_Hs01_00197471 predicted 1299
13 SASI_Hs01_00197475 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060106 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295407 predicted 969
2 SASI_Rn02_00295408 predicted 677
3 SASI_Rn02_00295409 predicted 1117
4 SASI_Rn02_00295410 predicted 755
5 SASI_Rn02_00295411 predicted 772
6 SASI_Rn02_00295412 predicted 747
7 SASI_Rn02_00295413 predicted 1684
8 SASI_Rn02_00295414 predicted 1642
9 SASI_Rn02_00295415 predicted 778
10 SASI_Rn02_00295416 predicted 837
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173386 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129826 predicted 657
2 SASI_Mm02_00345207 predicted 1486
3 SASI_Mm01_00129827 predicted 669
4 SASI_Mm01_00129828 predicted 692
5 SASI_Mm02_00345208 predicted 886
6 SASI_Mm02_00345209 predicted 1662
7 SASI_Mm01_00129830 predicted 729
8 SASI_Mm02_00345210 predicted 691
9 SASI_Mm01_00129833 predicted 735
10 SASI_Mm02_00345211 predicted 1451
11 SASI_Mm01_00129829 predicted 1122
12 SASI_Mm01_00129831 predicted 888
13 SASI_Mm01_00129832 predicted 1311
14 SASI_Mm01_00129834 predicted 790
15 SASI_Mm01_00129835 predicted 739
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138441
VALIDATED
MB21D1 MISSION shRNA Bacterial Glycerol Stock
Mab-21 domain containing 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138441.2-765s21c1
Sequence:CCGGTGAACACCGGGAGCTACTATGCTCGAGCATAGTAGCTCCCGGTGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138441.2-1605s21c1
Sequence:CCGGATCTATTCTCTAGCAACTTAACTCGAGTTAAGTTGCTAGAGAATAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138441.1-746s1c1
Sequence:CCGGCGTGAAGATTTCTGCACCTAACTCGAGTTAGGTGCAGAAATCTTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138441.1-920s1c1
Sequence:CCGGGATGCTGTCAAAGTTTAGGAACTCGAGTTCCTAAACTTTGACAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138441.1-1011s1c1
Sequence:CCGGCCTGCTGTAACACTTCTTATTCTCGAGAATAAGAAGTGTTACAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138441.1-1146s1c1
Sequence:CCGGCAACTACGACTAAAGCCATTTCTCGAGAAATGGCTTTAGTCGTAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138441.1-1484s1c1
Sequence:CCGGCTTTGATAACTGCGTGACATACTCGAGTATGTCACGCAGTTATCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138441.1-1296s1c1
Sequence:CCGGGAAGAGAAATGTTGCAGGAAACTCGAGTTTCCTGCAACATTTCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138441.1-910s1c1
Sequence:CCGGCAGCTTCTAAGATGCTGTCAACTCGAGTTGACAGCATCTTAGAAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138441.1-1414s1c1
Sequence:CCGGCTGCCTTCTTTCACGTATGTACTCGAGTACATACGTGAAAGAAGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138441.1-1483s1c1
Sequence:CCGGGCTTTGATAACTGCGTGACATCTCGAGATGTCACGCAGTTATCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138441
VALIDATED
MB21D1 MISSION shRNA shRNA Plasmid DNA
Mab-21 domain containing 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138441.2-765s21c1
Sequence:CCGGTGAACACCGGGAGCTACTATGCTCGAGCATAGTAGCTCCCGGTGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138441.2-1605s21c1
Sequence:CCGGATCTATTCTCTAGCAACTTAACTCGAGTTAAGTTGCTAGAGAATAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138441.1-746s1c1
Sequence:CCGGCGTGAAGATTTCTGCACCTAACTCGAGTTAGGTGCAGAAATCTTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138441.1-920s1c1
Sequence:CCGGGATGCTGTCAAAGTTTAGGAACTCGAGTTCCTAAACTTTGACAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138441.1-1011s1c1
Sequence:CCGGCCTGCTGTAACACTTCTTATTCTCGAGAATAAGAAGTGTTACAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138441.1-1146s1c1
Sequence:CCGGCAACTACGACTAAAGCCATTTCTCGAGAAATGGCTTTAGTCGTAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138441.1-1484s1c1
Sequence:CCGGCTTTGATAACTGCGTGACATACTCGAGTATGTCACGCAGTTATCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138441.1-1296s1c1
Sequence:CCGGGAAGAGAAATGTTGCAGGAAACTCGAGTTTCCTGCAACATTTCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138441.1-910s1c1
Sequence:CCGGCAGCTTCTAAGATGCTGTCAACTCGAGTTGACAGCATCTTAGAAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138441.1-1414s1c1
Sequence:CCGGCTGCCTTCTTTCACGTATGTACTCGAGTACATACGTGAAAGAAGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138441.1-1483s1c1
Sequence:CCGGGCTTTGATAACTGCGTGACATCTCGAGATGTCACGCAGTTATCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138441
VALIDATED
MB21D1 MISSION shRNA Lentiviral Transduction Particles
Mab-21 domain containing 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138441.2-765s21c1
Sequence:CCGGTGAACACCGGGAGCTACTATGCTCGAGCATAGTAGCTCCCGGTGTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138441.2-1605s21c1
Sequence:CCGGATCTATTCTCTAGCAACTTAACTCGAGTTAAGTTGCTAGAGAATAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138441.1-746s1c1
Sequence:CCGGCGTGAAGATTTCTGCACCTAACTCGAGTTAGGTGCAGAAATCTTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138441.1-920s1c1
Sequence:CCGGGATGCTGTCAAAGTTTAGGAACTCGAGTTCCTAAACTTTGACAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_138441.1-1011s1c1
Sequence:CCGGCCTGCTGTAACACTTCTTATTCTCGAGAATAAGAAGTGTTACAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138441.1-1146s1c1
Sequence:CCGGCAACTACGACTAAAGCCATTTCTCGAGAAATGGCTTTAGTCGTAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138441.1-1484s1c1
Sequence:CCGGCTTTGATAACTGCGTGACATACTCGAGTATGTCACGCAGTTATCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138441.1-1296s1c1
Sequence:CCGGGAAGAGAAATGTTGCAGGAAACTCGAGTTTCCTGCAACATTTCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138441.1-910s1c1
Sequence:CCGGCAGCTTCTAAGATGCTGTCAACTCGAGTTGACAGCATCTTAGAAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138441.1-1414s1c1
Sequence:CCGGCTGCCTTCTTTCACGTATGTACTCGAGTACATACGTGAAAGAAGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138441.1-1483s1c1
Sequence:CCGGGCTTTGATAACTGCGTGACATCTCGAGATGTCACGCAGTTATCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173386
MB21D1 MISSION shRNA Bacterial Glycerol Stock
Mab-21 domain containing 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173386.4-1477s21c1
Sequence:CCGGATTCCAAAGTTCAATCTATTCCTCGAGGAATAGATTGAACTTTGGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173386.4-1945s21c1
Sequence:CCGGACAGATGGACATCACCTATTCCTCGAGGAATAGGTGATGTCCATCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173386.4-540s1c1
Sequence:CCGGGAGATTGAAACGCAAAGATATCTCGAGATATCTTTGCGTTTCAATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173386.4-1492s1c1
Sequence:CCGGCTATTCTCTCAAGAACTAATTCTCGAGAATTAGTTCTTGAGAGAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173386.4-801s21c1
Sequence:CCGGAGGAAATCCGCTGAGTCATTTCTCGAGAAATGACTCAGCGGATTTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173386.1-1122s1c1
Sequence:CCGGGTACCAAAGAAGGACTACCTACTCGAGTAGGTAGTCCTTCTTTGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173386.1-822s1c1
Sequence:CCGGCCAGGATTGAGCTACAAGAATCTCGAGATTCTTGTAGCTCAATCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173386.1-3047s1c1
Sequence:CCGGCCTCTTTAGGATTGTCAGAATCTCGAGATTCTGACAATCCTAAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173386.1-1074s1c1
Sequence:CCGGCTGTGGATATAATTCTGGCTTCTCGAGAAGCCAGAATTATATCCACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173386.1-753s1c1
Sequence:CCGGGCAGCTACTATGAACATGTGACTCGAGTCACATGTTCATAGTAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173386.1-1824s1c1
Sequence:CCGGGCTGGTCTTGAACAAAGAGATCTCGAGATCTCTTTGTTCAAGACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173386
MB21D1 MISSION shRNA shRNA Plasmid DNA
Mab-21 domain containing 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173386.4-1477s21c1
Sequence:CCGGATTCCAAAGTTCAATCTATTCCTCGAGGAATAGATTGAACTTTGGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173386.4-1945s21c1
Sequence:CCGGACAGATGGACATCACCTATTCCTCGAGGAATAGGTGATGTCCATCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173386.4-540s1c1
Sequence:CCGGGAGATTGAAACGCAAAGATATCTCGAGATATCTTTGCGTTTCAATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173386.4-1492s1c1
Sequence:CCGGCTATTCTCTCAAGAACTAATTCTCGAGAATTAGTTCTTGAGAGAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173386.4-801s21c1
Sequence:CCGGAGGAAATCCGCTGAGTCATTTCTCGAGAAATGACTCAGCGGATTTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173386.1-1122s1c1
Sequence:CCGGGTACCAAAGAAGGACTACCTACTCGAGTAGGTAGTCCTTCTTTGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173386.1-822s1c1
Sequence:CCGGCCAGGATTGAGCTACAAGAATCTCGAGATTCTTGTAGCTCAATCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173386.1-3047s1c1
Sequence:CCGGCCTCTTTAGGATTGTCAGAATCTCGAGATTCTGACAATCCTAAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173386.1-1074s1c1
Sequence:CCGGCTGTGGATATAATTCTGGCTTCTCGAGAAGCCAGAATTATATCCACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173386.1-753s1c1
Sequence:CCGGGCAGCTACTATGAACATGTGACTCGAGTCACATGTTCATAGTAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173386.1-1824s1c1
Sequence:CCGGGCTGGTCTTGAACAAAGAGATCTCGAGATCTCTTTGTTCAAGACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173386
MB21D1 MISSION shRNA Lentiviral Transduction Particles
Mab-21 domain containing 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173386.4-1477s21c1
Sequence:CCGGATTCCAAAGTTCAATCTATTCCTCGAGGAATAGATTGAACTTTGGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173386.4-1945s21c1
Sequence:CCGGACAGATGGACATCACCTATTCCTCGAGGAATAGGTGATGTCCATCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173386.4-540s1c1
Sequence:CCGGGAGATTGAAACGCAAAGATATCTCGAGATATCTTTGCGTTTCAATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173386.4-1492s1c1
Sequence:CCGGCTATTCTCTCAAGAACTAATTCTCGAGAATTAGTTCTTGAGAGAATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173386.4-801s21c1
Sequence:CCGGAGGAAATCCGCTGAGTCATTTCTCGAGAAATGACTCAGCGGATTTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173386.1-1122s1c1
Sequence:CCGGGTACCAAAGAAGGACTACCTACTCGAGTAGGTAGTCCTTCTTTGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173386.1-822s1c1
Sequence:CCGGCCAGGATTGAGCTACAAGAATCTCGAGATTCTTGTAGCTCAATCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177514    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173386.1-3047s1c1
Sequence:CCGGCCTCTTTAGGATTGTCAGAATCTCGAGATTCTGACAATCCTAAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173386.1-1074s1c1
Sequence:CCGGCTGTGGATATAATTCTGGCTTCTCGAGAAGCCAGAATTATATCCACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173386.1-753s1c1
Sequence:CCGGGCAGCTACTATGAACATGTGACTCGAGTCACATGTTCATAGTAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173386.1-1824s1c1
Sequence:CCGGGCTGGTCTTGAACAAAGAGATCTCGAGATCTCTTTGTTCAAGACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)