EMAIL THIS PAGE TO A FRIEND

MB21D2

Mab-21 domain containing 2

160 Gene Product Result for
Synonyms: C3orf59
UniProtKB ID: Q8IYB1, Q86VD8
Gene ID:
Mouse(239796) Mab-21 domain containing 2
Rat(498100) Mab-21 domain containing 2
sheep(101103867) Mab-21 domain containing 2
naked mole-rat(101701742) Mab-21 domain containing 2
domestic guinea pig(100733726) Mab-21 domain containing 2
Zebrafish(556707) Mab-21 domain containing 2
chicken(424905) Mab-21 domain containing 2
dog(100684351) Mab-21 domain containing 2
cow(519376) Mab-21 domain containing 2
Horse(100059938) Mab-21 domain containing 2
domestic cat(101092206) Mab-21 domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177718 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177718 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177718 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178496 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178496 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178496 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178496 Rosetta Predictions human pricing
NM_001109056 Rosetta Predictions rat pricing
NM_177718 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178496 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369733 predicted 1470
2 SASI_Hs01_00122638 predicted 612
3 SASI_Hs01_00122639 predicted 799
4 SASI_Hs01_00122640 predicted 1006
5 SASI_Hs01_00122642 predicted 932
6 SASI_Hs02_00369734 predicted 1147
7 SASI_Hs01_00122644 predicted 653
8 SASI_Hs01_00122645 predicted 1404
9 SASI_Hs01_00122646 predicted 1260
10 SASI_Hs01_00122647 predicted 972
11 SASI_Hs01_00122641 predicted 815
12 SASI_Hs01_00122643 predicted 1464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109056 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244690 predicted 332
2 SASI_Rn02_00244691 predicted 1427
3 SASI_Rn02_00244692 predicted 1145
4 SASI_Rn02_00244693 predicted 1606
5 SASI_Rn02_00244694 predicted 1433
6 SASI_Rn02_00244695 predicted 1676
7 SASI_Rn02_00244696 predicted 1721
8 SASI_Rn02_00244697 predicted 1559
9 SASI_Rn02_00244698 predicted 1573
10 SASI_Rn02_00244699 predicted 1769
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177718 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173146 predicted 1287
2 SASI_Mm01_00173147 predicted 1136
3 SASI_Mm01_00173148 predicted 338
4 SASI_Mm01_00173149 predicted 933
5 SASI_Mm01_00173150 predicted 1379
6 SASI_Mm01_00173152 predicted 215
7 SASI_Mm01_00173153 predicted 1012
8 SASI_Mm01_00173154 predicted 1154
9 SASI_Mm01_00173155 predicted 525
10 SASI_Mm02_00348063 predicted 873
11 SASI_Mm01_00173151 predicted 374
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177718
VALIDATED
MB21D2 MISSION shRNA Bacterial Glycerol Stock
Mab-21 domain containing 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177718.2-1117s1c1
Sequence:CCGGCCCTAATTATTTCATCCCTCACTCGAGTGAGGGATGAAATAATTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177718.2-1103s1c1
Sequence:CCGGGTCAACAAGATGTGCCCTAATCTCGAGATTAGGGCACATCTTGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177718.2-298s1c1
Sequence:CCGGCCTAGATGAGTTAAACGTCTACTCGAGTAGACGTTTAACTCATCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177718.2-580s1c1
Sequence:CCGGCCTCTCGGAGATACAGAAGAACTCGAGTTCTTCTGTATCTCCGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177718.2-1046s1c1
Sequence:CCGGGAAGACTATGCAGCCCACTTTCTCGAGAAAGTGGGCTGCATAGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177718.2-243s1c1
Sequence:CCGGCCAACGAGTATCTGTTGCTCTCTCGAGAGAGCAACAGATACTCGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177718.3-1969s21c1
Sequence:CCGGGCATGCTGGCTGCGTTTATTTCTCGAGAAATAAACGCAGCCAGCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177718.3-1652s21c1
Sequence:CCGGTGCGGGCTCTGAAACAGTATTCTCGAGAATACTGTTTCAGAGCCCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177718.3-973s1c1
Sequence:CCGGGCAAAGCCATCATCATCAAACCTCGAGGTTTGATGATGATGGCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177718.3-1481s21c1
Sequence:CCGGCCATTTCAGAATCGATGATAACTCGAGTTATCATCGATTCTGAAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177718
VALIDATED
MB21D2 MISSION shRNA shRNA Plasmid DNA
Mab-21 domain containing 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177718.2-1117s1c1
Sequence:CCGGCCCTAATTATTTCATCCCTCACTCGAGTGAGGGATGAAATAATTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177718.2-1103s1c1
Sequence:CCGGGTCAACAAGATGTGCCCTAATCTCGAGATTAGGGCACATCTTGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177718.2-298s1c1
Sequence:CCGGCCTAGATGAGTTAAACGTCTACTCGAGTAGACGTTTAACTCATCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177718.2-580s1c1
Sequence:CCGGCCTCTCGGAGATACAGAAGAACTCGAGTTCTTCTGTATCTCCGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177718.2-1046s1c1
Sequence:CCGGGAAGACTATGCAGCCCACTTTCTCGAGAAAGTGGGCTGCATAGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177718.2-243s1c1
Sequence:CCGGCCAACGAGTATCTGTTGCTCTCTCGAGAGAGCAACAGATACTCGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177718.3-1969s21c1
Sequence:CCGGGCATGCTGGCTGCGTTTATTTCTCGAGAAATAAACGCAGCCAGCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177718.3-1652s21c1
Sequence:CCGGTGCGGGCTCTGAAACAGTATTCTCGAGAATACTGTTTCAGAGCCCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177718.3-973s1c1
Sequence:CCGGGCAAAGCCATCATCATCAAACCTCGAGGTTTGATGATGATGGCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177718.3-1481s21c1
Sequence:CCGGCCATTTCAGAATCGATGATAACTCGAGTTATCATCGATTCTGAAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177718
VALIDATED
MB21D2 MISSION shRNA Lentiviral Transduction Particles
Mab-21 domain containing 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177718.2-1117s1c1
Sequence:CCGGCCCTAATTATTTCATCCCTCACTCGAGTGAGGGATGAAATAATTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177718.2-1103s1c1
Sequence:CCGGGTCAACAAGATGTGCCCTAATCTCGAGATTAGGGCACATCTTGTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177718.2-298s1c1
Sequence:CCGGCCTAGATGAGTTAAACGTCTACTCGAGTAGACGTTTAACTCATCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177718.2-580s1c1
Sequence:CCGGCCTCTCGGAGATACAGAAGAACTCGAGTTCTTCTGTATCTCCGAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177718.2-1046s1c1
Sequence:CCGGGAAGACTATGCAGCCCACTTTCTCGAGAAAGTGGGCTGCATAGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177718.2-243s1c1
Sequence:CCGGCCAACGAGTATCTGTTGCTCTCTCGAGAGAGCAACAGATACTCGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177718.3-1969s21c1
Sequence:CCGGGCATGCTGGCTGCGTTTATTTCTCGAGAAATAAACGCAGCCAGCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177718.3-1652s21c1
Sequence:CCGGTGCGGGCTCTGAAACAGTATTCTCGAGAATACTGTTTCAGAGCCCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177718.3-973s1c1
Sequence:CCGGGCAAAGCCATCATCATCAAACCTCGAGGTTTGATGATGATGGCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177718.3-1481s21c1
Sequence:CCGGCCATTTCAGAATCGATGATAACTCGAGTTATCATCGATTCTGAAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178496
VALIDATED
MB21D2 MISSION shRNA Bacterial Glycerol Stock
Mab-21 domain containing 2
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178496.2-1004s1c1
Sequence:CCGGGTAGTCGCATGTTGTATGATACTCGAGTATCATACAACATGCGACTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178496.2-1030s1c1
Sequence:CCGGCCTGTGGTATCTTTCAAAGGTCTCGAGACCTTTGAAAGATACCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178496.2-1735s1c1
Sequence:CCGGGTCTTTATCAATCCTGACGATCTCGAGATCGTCAGGATTGATAAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178496.2-2021s1c1
Sequence:CCGGGCTCTTTAGTTTGTTGGAGTTCTCGAGAACTCCAACAAACTAAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178496.2-2646s1c1
Sequence:CCGGGCCCATTTCTATCAGTGAAATCTCGAGATTTCACTGATAGAAATGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178496.2-618s1c1
Sequence:CCGGCCTGGACTTAGATGAGCTTAACTCGAGTTAAGCTCATCTAAGTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178496.2-619s1c1
Sequence:CCGGCTGGACTTAGATGAGCTTAATCTCGAGATTAAGCTCATCTAAGTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178496.3-2224s21c1
Sequence:CCGGCTTTCACCACTACTGATATTTCTCGAGAAATATCAGTAGTGGTGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178496.3-1258s21c1
Sequence:CCGGTGCAAAGCCATCATCATTAAACTCGAGTTTAATGATGATGGCTTTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178496.3-1404s21c1
Sequence:CCGGCATCGATGACCTGCAACACTGCTCGAGCAGTGTTGCAGGTCATCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178496.3-1157s21c1
Sequence:CCGGACAAGGGTAAGAAGGACAATGCTCGAGCATTGTCCTTCTTACCCTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178496.3-664s21c1
Sequence:CCGGGATATGGACTTTACCCTCTTGCTCGAGCAAGAGGGTAAAGTCCATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178496.3-558s21c1
Sequence:CCGGGCTTCCAGTGGCTAATGAATACTCGAGTATTCATTAGCCACTGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178496.3-2167s21c1
Sequence:CCGGCTTAACGATTCTATCCTATTACTCGAGTAATAGGATAGAATCGTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178496.3-833s21c1
Sequence:CCGGTCAATGGTGCCACCAACTACTCTCGAGAGTAGTTGGTGGCACCATTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178496.3-1711s21c1
Sequence:CCGGGAGAACCCGGGAAAGTCAATCCTCGAGGATTGACTTTCCCGGGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178496
VALIDATED
MB21D2 MISSION shRNA shRNA Plasmid DNA
Mab-21 domain containing 2
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178496.2-1004s1c1
Sequence:CCGGGTAGTCGCATGTTGTATGATACTCGAGTATCATACAACATGCGACTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178496.2-1030s1c1
Sequence:CCGGCCTGTGGTATCTTTCAAAGGTCTCGAGACCTTTGAAAGATACCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178496.2-1735s1c1
Sequence:CCGGGTCTTTATCAATCCTGACGATCTCGAGATCGTCAGGATTGATAAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178496.2-2021s1c1
Sequence:CCGGGCTCTTTAGTTTGTTGGAGTTCTCGAGAACTCCAACAAACTAAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178496.2-2646s1c1
Sequence:CCGGGCCCATTTCTATCAGTGAAATCTCGAGATTTCACTGATAGAAATGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178496.2-618s1c1
Sequence:CCGGCCTGGACTTAGATGAGCTTAACTCGAGTTAAGCTCATCTAAGTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178496.2-619s1c1
Sequence:CCGGCTGGACTTAGATGAGCTTAATCTCGAGATTAAGCTCATCTAAGTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178496.3-2224s21c1
Sequence:CCGGCTTTCACCACTACTGATATTTCTCGAGAAATATCAGTAGTGGTGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178496.3-1258s21c1
Sequence:CCGGTGCAAAGCCATCATCATTAAACTCGAGTTTAATGATGATGGCTTTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178496.3-1404s21c1
Sequence:CCGGCATCGATGACCTGCAACACTGCTCGAGCAGTGTTGCAGGTCATCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178496.3-1157s21c1
Sequence:CCGGACAAGGGTAAGAAGGACAATGCTCGAGCATTGTCCTTCTTACCCTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178496.3-664s21c1
Sequence:CCGGGATATGGACTTTACCCTCTTGCTCGAGCAAGAGGGTAAAGTCCATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178496.3-558s21c1
Sequence:CCGGGCTTCCAGTGGCTAATGAATACTCGAGTATTCATTAGCCACTGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178496.3-2167s21c1
Sequence:CCGGCTTAACGATTCTATCCTATTACTCGAGTAATAGGATAGAATCGTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178496.3-833s21c1
Sequence:CCGGTCAATGGTGCCACCAACTACTCTCGAGAGTAGTTGGTGGCACCATTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178496.3-1711s21c1
Sequence:CCGGGAGAACCCGGGAAAGTCAATCCTCGAGGATTGACTTTCCCGGGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178496
VALIDATED
MB21D2 MISSION shRNA Lentiviral Transduction Particles
Mab-21 domain containing 2
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178496.2-1004s1c1
Sequence:CCGGGTAGTCGCATGTTGTATGATACTCGAGTATCATACAACATGCGACTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178496.2-1030s1c1
Sequence:CCGGCCTGTGGTATCTTTCAAAGGTCTCGAGACCTTTGAAAGATACCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178496.2-1735s1c1
Sequence:CCGGGTCTTTATCAATCCTGACGATCTCGAGATCGTCAGGATTGATAAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178496.2-2021s1c1
Sequence:CCGGGCTCTTTAGTTTGTTGGAGTTCTCGAGAACTCCAACAAACTAAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178496.2-2646s1c1
Sequence:CCGGGCCCATTTCTATCAGTGAAATCTCGAGATTTCACTGATAGAAATGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178496.2-618s1c1
Sequence:CCGGCCTGGACTTAGATGAGCTTAACTCGAGTTAAGCTCATCTAAGTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178496.2-619s1c1
Sequence:CCGGCTGGACTTAGATGAGCTTAATCTCGAGATTAAGCTCATCTAAGTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178496.3-2224s21c1
Sequence:CCGGCTTTCACCACTACTGATATTTCTCGAGAAATATCAGTAGTGGTGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178496.3-1258s21c1
Sequence:CCGGTGCAAAGCCATCATCATTAAACTCGAGTTTAATGATGATGGCTTTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178496.3-1404s21c1
Sequence:CCGGCATCGATGACCTGCAACACTGCTCGAGCAGTGTTGCAGGTCATCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178496.3-1157s21c1
Sequence:CCGGACAAGGGTAAGAAGGACAATGCTCGAGCATTGTCCTTCTTACCCTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178496.3-664s21c1
Sequence:CCGGGATATGGACTTTACCCTCTTGCTCGAGCAAGAGGGTAAAGTCCATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178496.3-558s21c1
Sequence:CCGGGCTTCCAGTGGCTAATGAATACTCGAGTATTCATTAGCCACTGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178496.3-2167s21c1
Sequence:CCGGCTTAACGATTCTATCCTATTACTCGAGTAATAGGATAGAATCGTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178496.3-833s21c1
Sequence:CCGGTCAATGGTGCCACCAACTACTCTCGAGAGTAGTTGGTGGCACCATTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178496.3-1711s21c1
Sequence:CCGGGAGAACCCGGGAAAGTCAATCCTCGAGGATTGACTTTCCCGGGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)