EMAIL THIS PAGE TO A FRIEND

MB

myoglobin

88 Gene Product Result for
Synonyms: PVALB
UniProtKB ID: P02144, Q52H51, Q5THY7
Gene ID:
Human(4151) Summary: This gene encodes a member of the globin superfamily and is expressed in skeletal and cardiac muscles. The encoded protein is a haemoprotein contributing to intracellular oxygen storage and transcellular facilitated diffusion of oxygen. At least three alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
Mouse(17189) myoglobin
Rat(59108) myoglobin
Goat(100860833) myoglobin
Zebrafish(393558) myoglobin
chicken(418056) myoglobin
dog(608715) myoglobin
fruit fly(249737) minus bar
cow(280695) myoglobin
Horse(100054434) myoglobin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0715 Human MB / Myoglobin ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013593 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013593 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013593 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_203377 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203377 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203377 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158361 MISSION® esiRNA esiRNA human MB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005368 Rosetta Predictions human pricing
NM_203377 Rosetta Predictions human pricing
NM_203378 Rosetta Predictions human pricing
NM_021588 Rosetta Predictions rat pricing
NM_013593 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005368 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054614 predicted 502
2 SASI_Hs02_00339457 predicted 777
3 SASI_Hs01_00054616 predicted 594
4 SASI_Hs01_00054617 predicted 624
5 SASI_Hs02_00339458 predicted 824
6 SASI_Hs01_00054618 predicted 784
7 SASI_Hs01_00054619 predicted 601
8 SASI_Hs02_00339459 predicted 785
9 SASI_Hs02_00339460 predicted 810
10 SASI_Hs02_00339461 predicted 488
11 SASI_Hs01_00054612 predicted 634
12 SASI_Hs01_00054613 predicted 327
13 SASI_Hs01_00054615 predicted 320
14 SASI_Hs01_00054620 predicted 636
15 SASI_Hs01_00054621 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203377 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193955 predicted 592
2 SASI_Hs02_00373304 predicted 878
3 SASI_Hs01_00193957 predicted 687
4 SASI_Hs01_00193958 predicted 712
5 SASI_Hs02_00373305 predicted 923
6 SASI_Hs01_00193959 predicted 880
7 SASI_Hs01_00193960 predicted 689
8 SASI_Hs02_00373306 predicted 875
9 SASI_Hs02_00373307 predicted 895
10 SASI_Hs02_00373308 predicted 576
11 SASI_Hs01_00193953 predicted 727
12 SASI_Hs01_00193954 predicted 414
13 SASI_Hs01_00193956 predicted 410
14 SASI_Hs01_00193961 predicted 735
15 SASI_Hs01_00193962 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203378 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055962 predicted 573
2 SASI_Hs02_00373309 predicted 858
3 SASI_Hs01_00055964 predicted 669
4 SASI_Hs01_00055965 predicted 696
5 SASI_Hs02_00373310 predicted 906
6 SASI_Hs01_00055966 predicted 861
7 SASI_Hs01_00055967 predicted 675
8 SASI_Hs02_00373311 predicted 862
9 SASI_Hs02_00373312 predicted 883
10 SASI_Hs02_00373313 predicted 562
11 SASI_Hs01_00055960 predicted 709
12 SASI_Hs01_00055961 predicted 397
13 SASI_Hs01_00055963 predicted 403
14 SASI_Hs01_00055968 predicted 718
15 SASI_Hs01_00055969 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021588 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114953 predicted 524
2 SASI_Rn01_00114955 predicted 327
3 SASI_Rn01_00114956 predicted 525
4 SASI_Rn02_00262629 predicted 328
5 SASI_Rn01_00114958 predicted 510
6 SASI_Rn01_00114959 predicted 517
7 SASI_Rn01_00114960 predicted 313
8 SASI_Rn01_00114961 predicted 617
9 SASI_Rn02_00262630 predicted 523
10 SASI_Rn02_00262631 predicted 350
11 SASI_Rn01_00114954 predicted 439
12 SASI_Rn01_00114957 predicted 706
13 SASI_Rn01_00114962 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013593 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189186 predicted 600
2 SASI_Mm01_00189187 predicted 458
3 SASI_Mm01_00189188 predicted 573
4 SASI_Mm01_00189189 predicted 581
5 SASI_Mm01_00189190 predicted 465
6 SASI_Mm01_00189191 predicted 447
7 SASI_Mm01_00189192 predicted 662
8 SASI_Mm01_00189193 predicted 458
9 SASI_Mm01_00189194 predicted 464
10 SASI_Mm01_00189195 predicted 276
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013593
MB MISSION shRNA Bacterial Glycerol Stock
myoglobin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013593.2-477s1c1
Sequence:CCGGCTGGAGTTTATCTCAGAAATTCTCGAGAATTTCTGAGATAAACTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013593.2-667s1c1
Sequence:CCGGCCCAGTGTTGTGTAGCAAGTACTCGAGTACTTGCTACACAACACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013593.2-246s1c1
Sequence:CCGGGAAGTCCTCATCGGTCTGTTTCTCGAGAAACAGACCGATGAGGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013593.2-281s1c1
Sequence:CCGGGACCCTGGATAAGTTTGACAACTCGAGTTGTCAAACTTATCCAGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013593.2-594s1c1
Sequence:CCGGGCCGCCAAGTACAAGGAGCTACTCGAGTAGCTCCTTGTACTTGGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013593
MB MISSION shRNA shRNA Plasmid DNA
myoglobin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013593.2-477s1c1
Sequence:CCGGCTGGAGTTTATCTCAGAAATTCTCGAGAATTTCTGAGATAAACTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013593.2-667s1c1
Sequence:CCGGCCCAGTGTTGTGTAGCAAGTACTCGAGTACTTGCTACACAACACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013593.2-246s1c1
Sequence:CCGGGAAGTCCTCATCGGTCTGTTTCTCGAGAAACAGACCGATGAGGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013593.2-281s1c1
Sequence:CCGGGACCCTGGATAAGTTTGACAACTCGAGTTGTCAAACTTATCCAGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013593.2-594s1c1
Sequence:CCGGGCCGCCAAGTACAAGGAGCTACTCGAGTAGCTCCTTGTACTTGGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013593
MB MISSION shRNA Lentiviral Transduction Particles
myoglobin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013593.2-477s1c1
Sequence:CCGGCTGGAGTTTATCTCAGAAATTCTCGAGAATTTCTGAGATAAACTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013593.2-667s1c1
Sequence:CCGGCCCAGTGTTGTGTAGCAAGTACTCGAGTACTTGCTACACAACACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013593.2-246s1c1
Sequence:CCGGGAAGTCCTCATCGGTCTGTTTCTCGAGAAACAGACCGATGAGGACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013593.2-281s1c1
Sequence:CCGGGACCCTGGATAAGTTTGACAACTCGAGTTGTCAAACTTATCCAGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013593.2-594s1c1
Sequence:CCGGGCCGCCAAGTACAAGGAGCTACTCGAGTAGCTCCTTGTACTTGGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203377
MB MISSION shRNA Bacterial Glycerol Stock
myoglobin
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203377.1-198s21c1
Sequence:CCGGAGTTGGTGCTGAACGTCTGGGCTCGAGCCCAGACGTTCAGCACCAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203377.1-978s21c1
Sequence:CCGGTACACCTGACAGTAGCAATTGCTCGAGCAATTGCTACTGTCAGGTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203377.1-913s21c1
Sequence:CCGGCTAAATCCCAACCGAACTTCTCTCGAGAGAAGTTCGGTTGGGATTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203377.1-596s21c1
Sequence:CCGGGACATGGCCTCCAACTACAAGCTCGAGCTTGTAGTTGGAGGCCATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203377.1-284s1c1
Sequence:CCGGCCAGAGACTCTGGAGAAGTTTCTCGAGAAACTTCTCCAGAGTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203377.1-483s1c1
Sequence:CCGGACCTGGAGTTCATCTCGGAATCTCGAGATTCCGAGATGAACTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203377.1-415s1c1
Sequence:CCGGGCATCATGAGGCAGAGATTAACTCGAGTTAATCTCTGCCTCATGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203377.1-340s1c1
Sequence:CCGGGAAGGCGTCTGAGGACTTAAACTCGAGTTTAAGTCCTCAGACGCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203377.1-447s21c1
Sequence:CCGGAGTCGCATGCCACCAAGCACACTCGAGTGTGCTTGGTGGCATGCGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203377.1-697s21c1
Sequence:CCGGGATCTCGTGTAGCCATATAGACTCGAGTCTATATGGCTACACGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203377.1-254s21c1
Sequence:CCGGGAAGTCCTCATCAGGCTCTTTCTCGAGAAAGAGCCTGATGAGGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203377
MB MISSION shRNA shRNA Plasmid DNA
myoglobin
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203377.1-198s21c1
Sequence:CCGGAGTTGGTGCTGAACGTCTGGGCTCGAGCCCAGACGTTCAGCACCAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203377.1-978s21c1
Sequence:CCGGTACACCTGACAGTAGCAATTGCTCGAGCAATTGCTACTGTCAGGTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203377.1-913s21c1
Sequence:CCGGCTAAATCCCAACCGAACTTCTCTCGAGAGAAGTTCGGTTGGGATTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203377.1-596s21c1
Sequence:CCGGGACATGGCCTCCAACTACAAGCTCGAGCTTGTAGTTGGAGGCCATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203377.1-284s1c1
Sequence:CCGGCCAGAGACTCTGGAGAAGTTTCTCGAGAAACTTCTCCAGAGTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203377.1-483s1c1
Sequence:CCGGACCTGGAGTTCATCTCGGAATCTCGAGATTCCGAGATGAACTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203377.1-415s1c1
Sequence:CCGGGCATCATGAGGCAGAGATTAACTCGAGTTAATCTCTGCCTCATGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203377.1-340s1c1
Sequence:CCGGGAAGGCGTCTGAGGACTTAAACTCGAGTTTAAGTCCTCAGACGCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203377.1-447s21c1
Sequence:CCGGAGTCGCATGCCACCAAGCACACTCGAGTGTGCTTGGTGGCATGCGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203377.1-697s21c1
Sequence:CCGGGATCTCGTGTAGCCATATAGACTCGAGTCTATATGGCTACACGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203377.1-254s21c1
Sequence:CCGGGAAGTCCTCATCAGGCTCTTTCTCGAGAAAGAGCCTGATGAGGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203377
MB MISSION shRNA Lentiviral Transduction Particles
myoglobin
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203377.1-198s21c1
Sequence:CCGGAGTTGGTGCTGAACGTCTGGGCTCGAGCCCAGACGTTCAGCACCAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203377.1-978s21c1
Sequence:CCGGTACACCTGACAGTAGCAATTGCTCGAGCAATTGCTACTGTCAGGTGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203377.1-913s21c1
Sequence:CCGGCTAAATCCCAACCGAACTTCTCTCGAGAGAAGTTCGGTTGGGATTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203377.1-596s21c1
Sequence:CCGGGACATGGCCTCCAACTACAAGCTCGAGCTTGTAGTTGGAGGCCATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203377.1-284s1c1
Sequence:CCGGCCAGAGACTCTGGAGAAGTTTCTCGAGAAACTTCTCCAGAGTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203377.1-483s1c1
Sequence:CCGGACCTGGAGTTCATCTCGGAATCTCGAGATTCCGAGATGAACTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203377.1-415s1c1
Sequence:CCGGGCATCATGAGGCAGAGATTAACTCGAGTTAATCTCTGCCTCATGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203377.1-340s1c1
Sequence:CCGGGAAGGCGTCTGAGGACTTAAACTCGAGTTTAAGTCCTCAGACGCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203377.1-447s21c1
Sequence:CCGGAGTCGCATGCCACCAAGCACACTCGAGTGTGCTTGGTGGCATGCGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203377.1-697s21c1
Sequence:CCGGGATCTCGTGTAGCCATATAGACTCGAGTCTATATGGCTACACGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203377.1-254s21c1
Sequence:CCGGGAAGTCCTCATCAGGCTCTTTCTCGAGAAAGAGCCTGATGAGGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)