EMAIL THIS PAGE TO A FRIEND

MBD1

methyl-CpG binding domain protein 1

221 Gene Product Result for
Synonyms: CXXC3 PCM1 RFT
Gene ID:
Human(4152) Summary: The protein encoded by this gene is a member of a family of nuclear proteins related by the presence of a methyl-CpG binding domain (MBD). These proteins are capable of binding specifically to methylated DNA, and some members can also repress transcription from methylated gene promoters. This protein contains multiple domains: MBD at the N-terminus that functions both in binding to methylated DNA and in protein interactions; several CXXC-type zinc finger domains that mediate binding to non-methylated CpG dinucleotides; transcriptional repression domain (TRD) at the C-terminus that is involved in transcription repression and in protein interactions. Numerous alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Feb 2011]
Mouse(17190) methyl-CpG binding domain protein 1
Rat(291439) methyl-CpG binding domain protein 1
Zebrafish(334386) methyl-CpG binding domain protein 1
Thale Cress(828371) methyl-CPG-binding domain 1
domestic cat(101089807) methyl-CpG binding domain protein 1
dog(480218) methyl-CpG binding domain protein 1
Horse(100053867) methyl-CpG binding domain protein 1
cow(540558) methyl-CpG binding domain protein 1
domestic guinea pig(100724675) methyl-CpG binding domain protein 1
naked mole-rat(101724111) methyl-CpG binding domain protein 1
Domestic Rabbit(100340239) methyl-CpG binding domain protein 1
sheep(101116619) methyl-CpG binding domain protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002384 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002384 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002384 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013594 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013594 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013594 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU047071 MISSION® esiRNA esiRNA targeting mouse Mbd1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002384 Rosetta Predictions human pricing
NM_015844 Rosetta Predictions human pricing
NM_015845 Rosetta Predictions human pricing
NM_015846 Rosetta Predictions human pricing
NM_015847 Rosetta Predictions human pricing
NM_001011924 Rosetta Predictions rat pricing
XM_574171 Rosetta Predictions rat pricing
NM_013594 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002384 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054243 predicted 633
2 SASI_Hs01_00054244 predicted 565
3 SASI_Hs01_00054245 predicted 610
4 SASI_Hs01_00054246 predicted 712
5 SASI_Hs01_00054247 predicted 571
6 SASI_Hs01_00054248 predicted 555
7 SASI_Hs01_00054249 predicted 632
8 SASI_Hs01_00054250 predicted 594
9 SASI_Hs01_00054251 predicted 613
10 SASI_Hs02_00333732 predicted 669
11 SASI_Hs01_00054242 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015844 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086731 predicted 634
2 SASI_Hs01_00086732 predicted 559
3 SASI_Hs01_00086733 predicted 616
4 SASI_Hs01_00086734 predicted 714
5 SASI_Hs01_00086735 predicted 567
6 SASI_Hs01_00086736 predicted 555
7 SASI_Hs01_00086737 predicted 632
8 SASI_Hs01_00086738 predicted 588
9 SASI_Hs01_00086739 predicted 607
10 SASI_Hs02_00348432 predicted 666
11 SASI_Hs01_00086730 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223214 predicted 631
2 SASI_Hs01_00223215 predicted 566
3 SASI_Hs01_00223216 predicted 608
4 SASI_Hs01_00223217 predicted 709
5 SASI_Hs01_00223218 predicted 566
6 SASI_Hs01_00223219 predicted 552
7 SASI_Hs01_00223220 predicted 626
8 SASI_Hs01_00223221 predicted 593
9 SASI_Hs01_00223222 predicted 613
10 SASI_Hs02_00348433 predicted 663
11 SASI_Hs01_00223213 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015846 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125835 predicted 631
2 SASI_Hs01_00125836 predicted 557
3 SASI_Hs01_00125837 predicted 608
4 SASI_Hs01_00125838 predicted 713
5 SASI_Hs01_00125839 predicted 564
6 SASI_Hs01_00125840 predicted 557
7 SASI_Hs01_00125841 predicted 627
8 SASI_Hs01_00125842 predicted 596
9 SASI_Hs01_00125843 predicted 608
10 SASI_Hs02_00348434 predicted 666
11 SASI_Hs01_00125834 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039352 predicted 628
2 SASI_Hs01_00039353 predicted 558
3 SASI_Hs01_00039354 predicted 615
4 SASI_Hs01_00039355 predicted 709
5 SASI_Hs01_00039356 predicted 563
6 SASI_Hs01_00039357 predicted 554
7 SASI_Hs01_00039358 predicted 631
8 SASI_Hs01_00039359 predicted 588
9 SASI_Hs01_00039360 predicted 616
10 SASI_Hs02_00348435 predicted 663
11 SASI_Hs01_00039351 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011924 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035391 predicted 689
2 SASI_Rn01_00035392 predicted 341
3 SASI_Rn01_00035393 predicted 681
4 SASI_Rn01_00035394 predicted 857
5 SASI_Rn01_00035395 predicted 846
6 SASI_Rn01_00035396 predicted 1680
7 SASI_Rn01_00035397 predicted 1840
8 SASI_Rn01_00035398 predicted 1432
9 SASI_Rn01_00035399 predicted 1140
10 SASI_Rn01_00035400 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574171 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00184251 predicted 2485
2 SASI_Rn01_00184252 predicted 1964
3 SASI_Rn01_00184253 predicted 2126
4 SASI_Rn01_00184254 predicted 2324
5 SASI_Rn01_00184255 predicted 1724
6 SASI_Rn01_00184256 predicted 2380
7 SASI_Rn01_00184257 predicted 2500
8 SASI_Rn01_00184258 predicted 2113
9 SASI_Rn01_00184259 predicted 2048
10 SASI_Rn01_00184260 predicted 2369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013594 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070313 predicted 1865
2 SASI_Mm02_00322332 predicted 885
3 SASI_Mm02_00322333 predicted 1410
4 SASI_Mm02_00322334 predicted 1494
5 SASI_Mm02_00322335 predicted 1272
6 SASI_Mm01_00070315 predicted 320
7 SASI_Mm02_00322336 predicted 1795
8 SASI_Mm02_00322337 predicted 301
9 SASI_Mm02_00322338 predicted 1854
10 SASI_Mm02_00322339 predicted 1115
11 SASI_Mm01_00070314 predicted 487
12 SASI_Mm01_00070316 predicted 628
13 SASI_Mm01_00070317 predicted 347
14 SASI_Mm01_00070318 predicted 674
15 SASI_Mm01_00070319 predicted 1433
16 SASI_Mm01_00070320 predicted 377
17 SASI_Mm01_00070321 predicted 686
18 SASI_Mm01_00070322 predicted 2027
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002384
VALIDATED
MBD1 MISSION shRNA Bacterial Glycerol Stock
methyl-CpG binding domain protein 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002384.2-613s21c1
Sequence:CCGGTCACCCTCTTCGACTTCAAACCTCGAGGTTTGAAGTCGAAGAGGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002384.2-2152s21c1
Sequence:CCGGGCCCTTCCTCACAGAGTTAAACTCGAGTTTAACTCTGTGAGGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002384.2-1374s21c1
Sequence:CCGGCCTGCCGAGTTCATCTATTACCTCGAGGTAATAGATGAACTCGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002384.2-522s21c1
Sequence:CCGGGGACGCTCAGACACCTATTACCTCGAGGTAATAGGTGTCTGAGCGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002384.2-1840s21c1
Sequence:CCGGCACCCGTGATCACGGAGATTTCTCGAGAAATCTCCGTGATCACGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002384.2-1788s21c1
Sequence:CCGGGATGATTCTGCCTCCAAATTGCTCGAGCAATTTGGAGGCAGAATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002384.2-2332s21c1
Sequence:CCGGCACCAACCTTCCAAGTGTAAACTCGAGTTTACACTTGGAAGGTTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002384.1-2216s1c1
Sequence:CCGGCCTGAGGATAACTCAATATAACTCGAGTTATATTGAGTTATCCTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002384.1-634s1c1
Sequence:CCGGCCGGGAACAGAGAATGTTTAACTCGAGTTAAACATTCTCTGTTCCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002384.1-1082s1c1
Sequence:CCGGGAGTTCATCTATTACTGTGTACTCGAGTACACAGTAATAGATGAACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002384.1-273s1c1
Sequence:CCGGGCAAAGTTGAGCTGACTCGATCTCGAGATCGAGTCAGCTCAACTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002384.1-1607s1c1
Sequence:CCGGCCAAGGTCCAAAGACCTTAAACTCGAGTTTAAGGTCTTTGGACCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002384
VALIDATED
MBD1 MISSION shRNA shRNA Plasmid DNA
methyl-CpG binding domain protein 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002384.2-613s21c1
Sequence:CCGGTCACCCTCTTCGACTTCAAACCTCGAGGTTTGAAGTCGAAGAGGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002384.2-2152s21c1
Sequence:CCGGGCCCTTCCTCACAGAGTTAAACTCGAGTTTAACTCTGTGAGGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002384.2-1374s21c1
Sequence:CCGGCCTGCCGAGTTCATCTATTACCTCGAGGTAATAGATGAACTCGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002384.2-522s21c1
Sequence:CCGGGGACGCTCAGACACCTATTACCTCGAGGTAATAGGTGTCTGAGCGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002384.2-1840s21c1
Sequence:CCGGCACCCGTGATCACGGAGATTTCTCGAGAAATCTCCGTGATCACGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002384.2-1788s21c1
Sequence:CCGGGATGATTCTGCCTCCAAATTGCTCGAGCAATTTGGAGGCAGAATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002384.2-2332s21c1
Sequence:CCGGCACCAACCTTCCAAGTGTAAACTCGAGTTTACACTTGGAAGGTTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002384.1-2216s1c1
Sequence:CCGGCCTGAGGATAACTCAATATAACTCGAGTTATATTGAGTTATCCTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002384.1-634s1c1
Sequence:CCGGCCGGGAACAGAGAATGTTTAACTCGAGTTAAACATTCTCTGTTCCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002384.1-1082s1c1
Sequence:CCGGGAGTTCATCTATTACTGTGTACTCGAGTACACAGTAATAGATGAACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002384.1-273s1c1
Sequence:CCGGGCAAAGTTGAGCTGACTCGATCTCGAGATCGAGTCAGCTCAACTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002384.1-1607s1c1
Sequence:CCGGCCAAGGTCCAAAGACCTTAAACTCGAGTTTAAGGTCTTTGGACCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002384
VALIDATED
MBD1 MISSION shRNA Lentiviral Transduction Particles
methyl-CpG binding domain protein 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002384.2-613s21c1
Sequence:CCGGTCACCCTCTTCGACTTCAAACCTCGAGGTTTGAAGTCGAAGAGGGTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002384.2-2152s21c1
Sequence:CCGGGCCCTTCCTCACAGAGTTAAACTCGAGTTTAACTCTGTGAGGAAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002384.2-1374s21c1
Sequence:CCGGCCTGCCGAGTTCATCTATTACCTCGAGGTAATAGATGAACTCGGCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002384.2-522s21c1
Sequence:CCGGGGACGCTCAGACACCTATTACCTCGAGGTAATAGGTGTCTGAGCGTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002384.2-1840s21c1
Sequence:CCGGCACCCGTGATCACGGAGATTTCTCGAGAAATCTCCGTGATCACGGGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002384.2-1788s21c1
Sequence:CCGGGATGATTCTGCCTCCAAATTGCTCGAGCAATTTGGAGGCAGAATCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002384.2-2332s21c1
Sequence:CCGGCACCAACCTTCCAAGTGTAAACTCGAGTTTACACTTGGAAGGTTGGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002384.1-2216s1c1
Sequence:CCGGCCTGAGGATAACTCAATATAACTCGAGTTATATTGAGTTATCCTCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002384.1-634s1c1
Sequence:CCGGCCGGGAACAGAGAATGTTTAACTCGAGTTAAACATTCTCTGTTCCCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002384.1-1082s1c1
Sequence:CCGGGAGTTCATCTATTACTGTGTACTCGAGTACACAGTAATAGATGAACTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002384.1-273s1c1
Sequence:CCGGGCAAAGTTGAGCTGACTCGATCTCGAGATCGAGTCAGCTCAACTTTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002384.1-1607s1c1
Sequence:CCGGCCAAGGTCCAAAGACCTTAAACTCGAGTTTAAGGTCTTTGGACCTTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013594
VALIDATED
MBD1 MISSION shRNA Bacterial Glycerol Stock
methyl-CpG binding domain protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013594.2-1149s21c1
Sequence:CCGGAGCTGCACATCAGCGACATAGCTCGAGCTATGTCGCTGATGTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013594.2-257s21c1
Sequence:CCGGGGACGCTCAGACATCTATTACCTCGAGGTAATAGATGTCTGAGCGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013594.2-1797s21c1
Sequence:CCGGCGCCAGTGATCACGGAGATTTCTCGAGAAATCTCCGTGATCACTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013594.1-724s1c1
Sequence:CCGGCCGCGAACAGAGAATGTTTAACTCGAGTTAAACATTCTCTGTTCGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013594.1-1592s1c1
Sequence:CCGGCCTGACACAGACTTTGTGTTTCTCGAGAAACACAAAGTCTGTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013594.1-2008s1c1
Sequence:CCGGGCCAAGGCTACATAAACTGTTCTCGAGAACAGTTTATGTAGCCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013594.1-341s1c1
Sequence:CCGGGCATGTGATCTTACCCTGTTTCTCGAGAAACAGGGTAAGATCACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013594.1-1536s1c1
Sequence:CCGGGCCCTGTCCAAGATTCAAGAACTCGAGTTCTTGAATCTTGGACAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013594.2-2099s21c1
Sequence:CCGGACCAACCTTAACCGTGTATACCTCGAGGTATACACGGTTAAGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013594.2-887s21c1
Sequence:CCGGAGACGATGCCTGCGGATTATGCTCGAGCATAATCCGCAGGCATCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013594
VALIDATED
MBD1 MISSION shRNA shRNA Plasmid DNA
methyl-CpG binding domain protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013594.2-1149s21c1
Sequence:CCGGAGCTGCACATCAGCGACATAGCTCGAGCTATGTCGCTGATGTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013594.2-257s21c1
Sequence:CCGGGGACGCTCAGACATCTATTACCTCGAGGTAATAGATGTCTGAGCGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013594.2-1797s21c1
Sequence:CCGGCGCCAGTGATCACGGAGATTTCTCGAGAAATCTCCGTGATCACTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013594.1-724s1c1
Sequence:CCGGCCGCGAACAGAGAATGTTTAACTCGAGTTAAACATTCTCTGTTCGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013594.1-1592s1c1
Sequence:CCGGCCTGACACAGACTTTGTGTTTCTCGAGAAACACAAAGTCTGTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013594.1-2008s1c1
Sequence:CCGGGCCAAGGCTACATAAACTGTTCTCGAGAACAGTTTATGTAGCCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013594.1-341s1c1
Sequence:CCGGGCATGTGATCTTACCCTGTTTCTCGAGAAACAGGGTAAGATCACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013594.1-1536s1c1
Sequence:CCGGGCCCTGTCCAAGATTCAAGAACTCGAGTTCTTGAATCTTGGACAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013594.2-2099s21c1
Sequence:CCGGACCAACCTTAACCGTGTATACCTCGAGGTATACACGGTTAAGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013594.2-887s21c1
Sequence:CCGGAGACGATGCCTGCGGATTATGCTCGAGCATAATCCGCAGGCATCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013594
VALIDATED
MBD1 MISSION shRNA Lentiviral Transduction Particles
methyl-CpG binding domain protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013594.2-1149s21c1
Sequence:CCGGAGCTGCACATCAGCGACATAGCTCGAGCTATGTCGCTGATGTGCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013594.2-257s21c1
Sequence:CCGGGGACGCTCAGACATCTATTACCTCGAGGTAATAGATGTCTGAGCGTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013594.2-1797s21c1
Sequence:CCGGCGCCAGTGATCACGGAGATTTCTCGAGAAATCTCCGTGATCACTGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013594.1-724s1c1
Sequence:CCGGCCGCGAACAGAGAATGTTTAACTCGAGTTAAACATTCTCTGTTCGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013594.1-1592s1c1
Sequence:CCGGCCTGACACAGACTTTGTGTTTCTCGAGAAACACAAAGTCTGTGTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013594.1-2008s1c1
Sequence:CCGGGCCAAGGCTACATAAACTGTTCTCGAGAACAGTTTATGTAGCCTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013594.1-341s1c1
Sequence:CCGGGCATGTGATCTTACCCTGTTTCTCGAGAAACAGGGTAAGATCACATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013594.1-1536s1c1
Sequence:CCGGGCCCTGTCCAAGATTCAAGAACTCGAGTTCTTGAATCTTGGACAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013594.2-2099s21c1
Sequence:CCGGACCAACCTTAACCGTGTATACCTCGAGGTATACACGGTTAAGGTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013594.2-887s21c1
Sequence:CCGGAGACGATGCCTGCGGATTATGCTCGAGCATAATCCGCAGGCATCGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)