EMAIL THIS PAGE TO A FRIEND

MBD3L1

methyl-CpG binding domain protein 3-like 1

51 Gene Product Result for
Synonyms: MBD3L
UniProtKB ID: Q8WWY6, B5BUM6, Q2M291
Gene ID:
Human(85509) Summary: This gene encodes a protein that is related to methyl-CpG-binding proteins but lacks the methyl-CpG binding domain. The protein is localized to discrete areas in the nucleus, and expression appears to be restricted to round spermatids, suggesting that the protein plays a role in the postmeiotic stages of male germ cell development. [provided by RefSeq, Jul 2008]
Mouse(73503) methyl-CpG binding domain protein 3-like 1
Rat(300389) methyl-CpG binding domain protein 3-like 1
cow(768027) methyl-CpG binding domain protein 3-like 1
domestic cat(101081786) methyl-CpG binding domain protein 3-like 1
naked mole-rat(101698203) methyl-CpG binding domain protein 3-like 1
domestic guinea pig(100717039) methyl-CpG binding domain protein 3-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145208 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145208 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145208 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028557 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028557 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028557 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144591 MISSION® esiRNA esiRNA human MBD3L1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145208 Rosetta Predictions human pricing
NM_001106803 Rosetta Predictions rat pricing
NM_028557 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145208 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027076 predicted 276
2 SASI_Hs01_00027077 predicted 374
3 SASI_Hs02_00365058 predicted 273
4 SASI_Hs01_00027078 predicted 408
5 SASI_Hs01_00027079 predicted 391
6 SASI_Hs01_00027080 predicted 325
7 SASI_Hs01_00027081 predicted 259
8 SASI_Hs01_00027082 predicted 238
9 SASI_Hs01_00027084 predicted 307
10 SASI_Hs01_00027085 predicted 271
11 SASI_Hs01_00027083 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106803 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222558 predicted 418
2 SASI_Rn02_00222559 predicted 249
3 SASI_Rn02_00222560 predicted 249
4 SASI_Rn02_00222561 predicted 478
5 SASI_Rn02_00222562 predicted 204
6 SASI_Rn02_00222563 predicted 529
7 SASI_Rn02_00222564 predicted 241
8 SASI_Rn02_00222565 predicted 542
9 SASI_Rn02_00222566 predicted 415
10 SASI_Rn02_00222567 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028557 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185733 predicted 294
2 SASI_Mm01_00185736 predicted 357
3 SASI_Mm01_00185740 predicted 228
4 SASI_Mm01_00185741 predicted 364
5 SASI_Mm02_00334042 predicted 406
6 SASI_Mm01_00185732 predicted 534
7 SASI_Mm01_00185734 predicted 467
8 SASI_Mm02_00334043 predicted 546
9 SASI_Mm01_00185735 predicted 243
10 SASI_Mm01_00185737 predicted 330
11 SASI_Mm01_00185738 predicted 393
12 SASI_Mm01_00185739 predicted 436
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145208
MBD3L1 MISSION shRNA Bacterial Glycerol Stock
methyl-CpG binding domain protein 3-like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145208.1-277s1c1
Sequence:CCGGGCACTTTGGATCTTGCCAATACTCGAGTATTGGCAAGATCCAAAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145208.1-91s1c1
Sequence:CCGGGCACCTCAATCCCTTTGAGAACTCGAGTTCTCAAAGGGATTGAGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145208.1-512s1c1
Sequence:CCGGAGTCAGAGAGAGACTCGCAATCTCGAGATTGCGAGTCTCTCTCTGACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145208.1-101s1c1
Sequence:CCGGCCCTTTGAGAATGTCCAGTTACTCGAGTAACTGGACATTCTCAAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145208.2-191s21c1
Sequence:CCGGCAAGAGGCCAGTAACGAGAATCTCGAGATTCTCGTTACTGGCCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145208.2-381s21c1
Sequence:CCGGAGTTACACAGGTGGATCTCTGCTCGAGCAGAGATCCACCTGTGTAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145208.2-462s21c1
Sequence:CCGGTCAGATGCGGTGGAGATAATTCTCGAGAATTATCTCCACCGCATCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145208.2-123s21c1
Sequence:CCGGGTAAACCAATGCAAATCAAAGCTCGAGCTTTGATTTGCATTGGTTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145208
MBD3L1 MISSION shRNA shRNA Plasmid DNA
methyl-CpG binding domain protein 3-like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145208.1-277s1c1
Sequence:CCGGGCACTTTGGATCTTGCCAATACTCGAGTATTGGCAAGATCCAAAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145208.1-91s1c1
Sequence:CCGGGCACCTCAATCCCTTTGAGAACTCGAGTTCTCAAAGGGATTGAGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145208.1-512s1c1
Sequence:CCGGAGTCAGAGAGAGACTCGCAATCTCGAGATTGCGAGTCTCTCTCTGACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145208.1-101s1c1
Sequence:CCGGCCCTTTGAGAATGTCCAGTTACTCGAGTAACTGGACATTCTCAAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145208.2-191s21c1
Sequence:CCGGCAAGAGGCCAGTAACGAGAATCTCGAGATTCTCGTTACTGGCCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145208.2-381s21c1
Sequence:CCGGAGTTACACAGGTGGATCTCTGCTCGAGCAGAGATCCACCTGTGTAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145208.2-462s21c1
Sequence:CCGGTCAGATGCGGTGGAGATAATTCTCGAGAATTATCTCCACCGCATCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145208.2-123s21c1
Sequence:CCGGGTAAACCAATGCAAATCAAAGCTCGAGCTTTGATTTGCATTGGTTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145208
MBD3L1 MISSION shRNA Lentiviral Transduction Particles
methyl-CpG binding domain protein 3-like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145208.1-277s1c1
Sequence:CCGGGCACTTTGGATCTTGCCAATACTCGAGTATTGGCAAGATCCAAAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145208.1-91s1c1
Sequence:CCGGGCACCTCAATCCCTTTGAGAACTCGAGTTCTCAAAGGGATTGAGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145208.1-512s1c1
Sequence:CCGGAGTCAGAGAGAGACTCGCAATCTCGAGATTGCGAGTCTCTCTCTGACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145208.1-101s1c1
Sequence:CCGGCCCTTTGAGAATGTCCAGTTACTCGAGTAACTGGACATTCTCAAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145208.2-191s21c1
Sequence:CCGGCAAGAGGCCAGTAACGAGAATCTCGAGATTCTCGTTACTGGCCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145208.2-381s21c1
Sequence:CCGGAGTTACACAGGTGGATCTCTGCTCGAGCAGAGATCCACCTGTGTAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145208.2-462s21c1
Sequence:CCGGTCAGATGCGGTGGAGATAATTCTCGAGAATTATCTCCACCGCATCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145208.2-123s21c1
Sequence:CCGGGTAAACCAATGCAAATCAAAGCTCGAGCTTTGATTTGCATTGGTTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028557
MBD3L1 MISSION shRNA Bacterial Glycerol Stock
methyl-CpG binding domain protein 3-like 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028557.1-440s1c1
Sequence:CCGGCCACCAGCATTGACATCACATCTCGAGATGTGATGTCAATGCTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028557.1-379s1c1
Sequence:CCGGGCCAAGACTTTGAAAGATCTTCTCGAGAAGATCTTTCAAAGTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028557.1-610s1c1
Sequence:CCGGGCGTTGATTGCACACAAGCTACTCGAGTAGCTTGTGTGCAATCAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028557.1-553s1c1
Sequence:CCGGCAGGATATTATTAACCAGGAACTCGAGTTCCTGGTTAATAATATCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028557.1-191s1c1
Sequence:CCGGCCTTGAGGATGTCTAGTTATACTCGAGTATAACTAGACATCCTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028557.2-157s21c1
Sequence:CCGGACCCATCAAAGCCTTGTTTAACTCGAGTTAAACAAGGCTTTGATGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028557.2-470s21c1
Sequence:CCGGCCTTGAGTCATCTTCACATTTCTCGAGAAATGTGAAGATGACTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028557.2-407s21c1
Sequence:CCGGAGACACAGTTGCGTCTGCTTCCTCGAGGAAGCAGACGCAACTGTGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028557
MBD3L1 MISSION shRNA shRNA Plasmid DNA
methyl-CpG binding domain protein 3-like 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028557.1-440s1c1
Sequence:CCGGCCACCAGCATTGACATCACATCTCGAGATGTGATGTCAATGCTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028557.1-379s1c1
Sequence:CCGGGCCAAGACTTTGAAAGATCTTCTCGAGAAGATCTTTCAAAGTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028557.1-610s1c1
Sequence:CCGGGCGTTGATTGCACACAAGCTACTCGAGTAGCTTGTGTGCAATCAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028557.1-553s1c1
Sequence:CCGGCAGGATATTATTAACCAGGAACTCGAGTTCCTGGTTAATAATATCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028557.1-191s1c1
Sequence:CCGGCCTTGAGGATGTCTAGTTATACTCGAGTATAACTAGACATCCTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028557.2-157s21c1
Sequence:CCGGACCCATCAAAGCCTTGTTTAACTCGAGTTAAACAAGGCTTTGATGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028557.2-470s21c1
Sequence:CCGGCCTTGAGTCATCTTCACATTTCTCGAGAAATGTGAAGATGACTCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028557.2-407s21c1
Sequence:CCGGAGACACAGTTGCGTCTGCTTCCTCGAGGAAGCAGACGCAACTGTGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028557
MBD3L1 MISSION shRNA Lentiviral Transduction Particles
methyl-CpG binding domain protein 3-like 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028557.1-440s1c1
Sequence:CCGGCCACCAGCATTGACATCACATCTCGAGATGTGATGTCAATGCTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028557.1-379s1c1
Sequence:CCGGGCCAAGACTTTGAAAGATCTTCTCGAGAAGATCTTTCAAAGTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028557.1-610s1c1
Sequence:CCGGGCGTTGATTGCACACAAGCTACTCGAGTAGCTTGTGTGCAATCAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028557.1-553s1c1
Sequence:CCGGCAGGATATTATTAACCAGGAACTCGAGTTCCTGGTTAATAATATCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028557.1-191s1c1
Sequence:CCGGCCTTGAGGATGTCTAGTTATACTCGAGTATAACTAGACATCCTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028557.2-157s21c1
Sequence:CCGGACCCATCAAAGCCTTGTTTAACTCGAGTTAAACAAGGCTTTGATGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028557.2-470s21c1
Sequence:CCGGCCTTGAGTCATCTTCACATTTCTCGAGAAATGTGAAGATGACTCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028557.2-407s21c1
Sequence:CCGGAGACACAGTTGCGTCTGCTTCCTCGAGGAAGCAGACGCAACTGTGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)