EMAIL THIS PAGE TO A FRIEND

MBD3L5

methyl-CpG binding domain protein 3-like 5

13 Gene Product Result for
Species: Human MBD3L5(284428)
UniProtKB ID: A6NJ08
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302000 ANTI-MBD3L5 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136507 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136507 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136507 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_208203 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_208203 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478921 predicted 336
2 SASI_Hs02_00478922 predicted 276
3 SASI_Hs02_00478923 predicted 213
4 SASI_Hs02_00478924 predicted 396
5 SASI_Hs02_00478925 predicted 517
6 SASI_Hs02_00478926 predicted 348
7 SASI_Hs02_00478927 predicted 338
8 SASI_Hs02_00478928 predicted 348
9 SASI_Hs02_00478929 predicted 344
10 SASI_Hs02_00478930 predicted 350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136507
MBD3L5 MISSION shRNA Bacterial Glycerol Stock
methyl-CpG binding domain protein 3-like 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136507.1-329s21c1
Sequence:CCGGCAGCCAAGGAGAAGGTTCAAGCTCGAGCTTGAACCTTCTCCTTGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136507.1-355s21c1
Sequence:CCGGTGCATTTGGAGAGCGTCTTAACTCGAGTTAAGACGCTCTCCAAATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136507.1-533s21c1
Sequence:CCGGATTGGTGACTCCTGCAGATATCTCGAGATATCTGCAGGAGTCACCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136507.1-236s21c1
Sequence:CCGGCAACCAGGTCAGACGCAGAAACTCGAGTTTCTGCGTCTGACCTGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136507.1-107s21c1
Sequence:CCGGTTTACAGAAGAAACGAGAAATCTCGAGATTTCTCGTTTCTTCTGTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136507
MBD3L5 MISSION shRNA shRNA Plasmid DNA
methyl-CpG binding domain protein 3-like 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136507.1-329s21c1
Sequence:CCGGCAGCCAAGGAGAAGGTTCAAGCTCGAGCTTGAACCTTCTCCTTGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136507.1-355s21c1
Sequence:CCGGTGCATTTGGAGAGCGTCTTAACTCGAGTTAAGACGCTCTCCAAATGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136507.1-533s21c1
Sequence:CCGGATTGGTGACTCCTGCAGATATCTCGAGATATCTGCAGGAGTCACCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136507.1-236s21c1
Sequence:CCGGCAACCAGGTCAGACGCAGAAACTCGAGTTTCTGCGTCTGACCTGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136507.1-107s21c1
Sequence:CCGGTTTACAGAAGAAACGAGAAATCTCGAGATTTCTCGTTTCTTCTGTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136507
MBD3L5 MISSION shRNA Lentiviral Transduction Particles
methyl-CpG binding domain protein 3-like 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136507.1-329s21c1
Sequence:CCGGCAGCCAAGGAGAAGGTTCAAGCTCGAGCTTGAACCTTCTCCTTGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136507.1-355s21c1
Sequence:CCGGTGCATTTGGAGAGCGTCTTAACTCGAGTTAAGACGCTCTCCAAATGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136507.1-533s21c1
Sequence:CCGGATTGGTGACTCCTGCAGATATCTCGAGATATCTGCAGGAGTCACCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136507.1-236s21c1
Sequence:CCGGCAACCAGGTCAGACGCAGAAACTCGAGTTTCTGCGTCTGACCTGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136507.1-107s21c1
Sequence:CCGGTTTACAGAAGAAACGAGAAATCTCGAGATTTCTCGTTTCTTCTGTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)