EMAIL THIS PAGE TO A FRIEND

MBD4

methyl-CpG binding domain protein 4

60 Gene Product Result for
Synonyms: MED1
UniProtKB ID: O95243, D3DNC3, D3DNC4, Q2MD36, Q7Z4T3, Q96F09
Gene ID:
Human(8930) Summary: The protein encoded by this gene is a member of a family of nuclear proteins related by the presence of a methyl-CpG binding domain (MBD). These proteins are capable of binding specifically to methylated DNA, and some members can also repress transcription from methylated gene promoters. This protein contains an MBD domain at the N-terminus that functions both in binding to methylated DNA and in protein interactions and a C-terminal mismatch-specific glycosylase domain that is involved in DNA repair. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
Mouse(17193) methyl-CpG binding domain protein 4
Rat(680915) methyl-CpG binding domain protein 4
Zebrafish(399691) methyl-CpG binding domain protein 4
Thale Cress(825478) methyl-CpG-binding domain-containing protein 4
dog(100684130) methyl-CpG binding domain protein 4
domestic cat(101097799) methyl-CpG binding domain protein 4
cow(511463) methyl-CpG binding domain protein 4
Horse(100056679) methyl-CpG binding domain protein 4
chicken(395428) methyl-CpG binding domain protein 4
domestic guinea pig(100715374) methyl-CpG binding domain protein 4
naked mole-rat(101724783) methyl-CpG binding domain protein 4
Domestic Rabbit(100339392) methyl-CpG binding domain protein 4
sheep(101102431) methyl-CpG binding domain protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003925 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003925 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003925 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010774 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010774 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010774 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003925 Rosetta Predictions human pricing
XM_001059437 Rosetta Predictions rat pricing
NM_010774 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014463 predicted 1338
2 SASI_Hs01_00014464 predicted 545
3 SASI_Hs01_00014465 predicted 357
4 SASI_Hs01_00014466 predicted 616
5 SASI_Hs01_00014467 predicted 1725
6 SASI_Hs01_00014468 predicted 685
7 SASI_Hs01_00014469 predicted 787
8 SASI_Hs01_00014471 predicted 481
9 SASI_Hs01_00014472 predicted 1758
10 SASI_Hs02_00336575 predicted 1742
11 SASI_Hs01_00014470 predicted 1318
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059437 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293167 predicted 715
2 SASI_Rn02_00293168 predicted 1000
3 SASI_Rn02_00293169 predicted 1059
4 SASI_Rn02_00293170 predicted 624
5 SASI_Rn02_00293171 predicted 857
6 SASI_Rn02_00293172 predicted 741
7 SASI_Rn02_00293173 predicted 1028
8 SASI_Rn02_00293174 predicted 1037
9 SASI_Rn02_00293175 predicted 883
10 SASI_Rn02_00293176 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010774 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319321 predicted 1642
2 SASI_Mm02_00319322 predicted 324
3 SASI_Mm01_00102677 predicted 366
4 SASI_Mm01_00102679 predicted 544
5 SASI_Mm01_00102680 predicted 1606
6 SASI_Mm01_00102681 predicted 204
7 SASI_Mm01_00102682 predicted 746
8 SASI_Mm02_00319323 predicted 1638
9 SASI_Mm01_00102683 predicted 547
10 SASI_Mm02_00319324 predicted 1492
11 SASI_Mm01_00102675 predicted 942
12 SASI_Mm01_00102676 predicted 679
13 SASI_Mm01_00102678 predicted 1416
14 SASI_Mm01_00102684 predicted 1097
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003925
VALIDATED
MBD4 MISSION shRNA Bacterial Glycerol Stock
methyl-CpG binding domain protein 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003925.1-749s21c1
Sequence:CCGGGCCAAGTAGTAGTTCAGAGTTCTCGAGAACTCTGAACTACTACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003925.1-1798s21c1
Sequence:CCGGGCAACGACTCTTACCGAATTTCTCGAGAAATTCGGTAAGAGTCGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003925.1-2034s21c1
Sequence:CCGGGCCTAGTGTGTGTGCTTTCTTCTCGAGAAGAAAGCACACACACTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003925.1-1463s21c1
Sequence:CCGGCCCACGACGTAAAGCCTTTAACTCGAGTTAAAGGCTTTACGTCGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003925.1-2034s1c1
Sequence:CCGGGCCTAGTGTGTGTGCTTTCTTCTCGAGAAGAAAGCACACACACTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003925.1-749s1c1
Sequence:CCGGGCCAAGTAGTAGTTCAGAGTTCTCGAGAACTCTGAACTACTACTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003925.1-1798s1c1
Sequence:CCGGGCAACGACTCTTACCGAATTTCTCGAGAAATTCGGTAAGAGTCGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003925.1-1463s1c1
Sequence:CCGGCCCACGACGTAAAGCCTTTAACTCGAGTTAAAGGCTTTACGTCGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003925.1-498s1c1
Sequence:CCGGGTGTACTTTATCAGCCCACAACTCGAGTTGTGGGCTGATAAAGTACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003925
VALIDATED
MBD4 MISSION shRNA shRNA Plasmid DNA
methyl-CpG binding domain protein 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003925.1-749s21c1
Sequence:CCGGGCCAAGTAGTAGTTCAGAGTTCTCGAGAACTCTGAACTACTACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003925.1-1798s21c1
Sequence:CCGGGCAACGACTCTTACCGAATTTCTCGAGAAATTCGGTAAGAGTCGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003925.1-2034s21c1
Sequence:CCGGGCCTAGTGTGTGTGCTTTCTTCTCGAGAAGAAAGCACACACACTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003925.1-1463s21c1
Sequence:CCGGCCCACGACGTAAAGCCTTTAACTCGAGTTAAAGGCTTTACGTCGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003925.1-2034s1c1
Sequence:CCGGGCCTAGTGTGTGTGCTTTCTTCTCGAGAAGAAAGCACACACACTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003925.1-749s1c1
Sequence:CCGGGCCAAGTAGTAGTTCAGAGTTCTCGAGAACTCTGAACTACTACTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003925.1-1798s1c1
Sequence:CCGGGCAACGACTCTTACCGAATTTCTCGAGAAATTCGGTAAGAGTCGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003925.1-1463s1c1
Sequence:CCGGCCCACGACGTAAAGCCTTTAACTCGAGTTAAAGGCTTTACGTCGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003925.1-498s1c1
Sequence:CCGGGTGTACTTTATCAGCCCACAACTCGAGTTGTGGGCTGATAAAGTACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003925
VALIDATED
MBD4 MISSION shRNA Lentiviral Transduction Particles
methyl-CpG binding domain protein 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003925.1-749s21c1
Sequence:CCGGGCCAAGTAGTAGTTCAGAGTTCTCGAGAACTCTGAACTACTACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003925.1-1798s21c1
Sequence:CCGGGCAACGACTCTTACCGAATTTCTCGAGAAATTCGGTAAGAGTCGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003925.1-2034s21c1
Sequence:CCGGGCCTAGTGTGTGTGCTTTCTTCTCGAGAAGAAAGCACACACACTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003925.1-1463s21c1
Sequence:CCGGCCCACGACGTAAAGCCTTTAACTCGAGTTAAAGGCTTTACGTCGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003925.1-2034s1c1
Sequence:CCGGGCCTAGTGTGTGTGCTTTCTTCTCGAGAAGAAAGCACACACACTAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003925.1-749s1c1
Sequence:CCGGGCCAAGTAGTAGTTCAGAGTTCTCGAGAACTCTGAACTACTACTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003925.1-1798s1c1
Sequence:CCGGGCAACGACTCTTACCGAATTTCTCGAGAAATTCGGTAAGAGTCGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_003925.1-1463s1c1
Sequence:CCGGCCCACGACGTAAAGCCTTTAACTCGAGTTAAAGGCTTTACGTCGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003925.1-498s1c1
Sequence:CCGGGTGTACTTTATCAGCCCACAACTCGAGTTGTGGGCTGATAAAGTACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010774
VALIDATED
MBD4 MISSION shRNA Bacterial Glycerol Stock
methyl-CpG binding domain protein 4
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000039076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010774.1-2023s1c1
Sequence:CCGGCCGATTGAGCTTCATGGCATTCTCGAGAATGCCATGAAGCTCAATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010774.1-1305s1c1
Sequence:CCGGGCCACAGGAAAGTCAACTCAACTCGAGTTGAGTTGACTTTCCTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010774.1-677s1c1
Sequence:CCGGCCACTGCTTCTACTCTGTCTACTCGAGTAGACAGAGTAGAAGCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010774
VALIDATED
MBD4 MISSION shRNA shRNA Plasmid DNA
methyl-CpG binding domain protein 4
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000039076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010774.1-2023s1c1
Sequence:CCGGCCGATTGAGCTTCATGGCATTCTCGAGAATGCCATGAAGCTCAATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010774.1-1305s1c1
Sequence:CCGGGCCACAGGAAAGTCAACTCAACTCGAGTTGAGTTGACTTTCCTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010774.1-677s1c1
Sequence:CCGGCCACTGCTTCTACTCTGTCTACTCGAGTAGACAGAGTAGAAGCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010774
VALIDATED
MBD4 MISSION shRNA Lentiviral Transduction Particles
methyl-CpG binding domain protein 4
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000039076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010774.1-2023s1c1
Sequence:CCGGCCGATTGAGCTTCATGGCATTCTCGAGAATGCCATGAAGCTCAATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010774.1-1305s1c1
Sequence:CCGGGCCACAGGAAAGTCAACTCAACTCGAGTTGAGTTGACTTTCCTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010774.1-677s1c1
Sequence:CCGGCCACTGCTTCTACTCTGTCTACTCGAGTAGACAGAGTAGAAGCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)