EMAIL THIS PAGE TO A FRIEND

MBIP

MAP3K12 binding inhibitory protein 1

77 Gene Product Result for
UniProtKB ID: Q9NS73, Q86TZ2, Q96AS5, Q9BS93, Q9NZE1
Gene ID:
Mouse(217588) MAP3K12 binding inhibitory protein 1
Rat(362740) MAP3K12 binding inhibitory protein 1
Zebrafish(402869) MAP3K12 binding inhibitory protein 1
chicken(423329) MAP3K12 binding inhibitory protein 1
domestic cat(101091629) MAP3K12 binding inhibitory protein 1
cow(774027) MAP3K12 binding inhibitory protein 1
dog(480293) MAP3K12 binding inhibitory protein 1
sheep(101120955) MAP3K12 binding inhibitory protein 1
naked mole-rat(101705635) MAP3K12 binding inhibitory protein 1
domestic guinea pig(100728535) MAP3K12 binding inhibitory protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145442 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145442 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145442 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016586 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016586 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016586 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016586 Rosetta Predictions human pricing
NM_001108712 Rosetta Predictions rat pricing
NM_145442 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016586 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024536 predicted 602
2 SASI_Hs01_00024537 predicted 763
3 SASI_Hs01_00024538 predicted 518
4 SASI_Hs01_00024539 predicted 1130
5 SASI_Hs01_00024540 predicted 739
6 SASI_Hs01_00024542 predicted 338
7 SASI_Hs01_00024543 predicted 1190
8 SASI_Hs01_00024544 predicted 690
9 SASI_Hs02_00349717 predicted 862
10 SASI_Hs02_00349718 predicted 1146
11 SASI_Hs01_00024541 predicted 266
12 SASI_Hs01_00024545 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108712 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241335 predicted 610
2 SASI_Rn02_00241336 predicted 930
3 SASI_Rn02_00241337 predicted 759
4 SASI_Rn02_00241338 predicted 1133
5 SASI_Rn02_00241339 predicted 741
6 SASI_Rn02_00241340 predicted 1161
7 SASI_Rn02_00241341 predicted 692
8 SASI_Rn02_00241342 predicted 807
9 SASI_Rn02_00241343 predicted 394
10 SASI_Rn02_00241344 predicted 775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145442 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029210 predicted 615
2 SASI_Mm01_00029211 predicted 541
3 SASI_Mm01_00029212 predicted 670
4 SASI_Mm01_00029213 predicted 800
5 SASI_Mm02_00340829 predicted 408
6 SASI_Mm01_00029214 predicted 734
7 SASI_Mm01_00029215 predicted 882
8 SASI_Mm01_00029216 predicted 1145
9 SASI_Mm01_00029217 predicted 713
10 SASI_Mm01_00029219 predicted 1129
11 SASI_Mm01_00029218 predicted 877
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145442
VALIDATED
MBIP MISSION shRNA Bacterial Glycerol Stock
MAP3K12 binding inhibitory protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145442.1-1146s1c1
Sequence:CCGGGCTTAACTATTTGCAGTGTATCTCGAGATACACTGCAAATAGTTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145442.1-298s1c1
Sequence:CCGGCTGCACTTGAACAACACGTTTCTCGAGAAACGTGTTGTTCAAGTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145442.1-942s1c1
Sequence:CCGGCCTGAATACTTCCAATCTGTACTCGAGTACAGATTGGAAGTATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145442.1-869s1c1
Sequence:CCGGCCCAGTACCAAGAGACATCTACTCGAGTAGATGTCTCTTGGTACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145442.1-399s1c1
Sequence:CCGGGCAGAGACCAAGAGTGAACTACTCGAGTAGTTCACTCTTGGTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145442.1-1146s21c1
Sequence:CCGGGCTTAACTATTTGCAGTGTATCTCGAGATACACTGCAAATAGTTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145442.1-399s21c1
Sequence:CCGGGCAGAGACCAAGAGTGAACTACTCGAGTAGTTCACTCTTGGTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145442.1-298s21c1
Sequence:CCGGCTGCACTTGAACAACACGTTTCTCGAGAAACGTGTTGTTCAAGTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145442.1-942s21c1
Sequence:CCGGCCTGAATACTTCCAATCTGTACTCGAGTACAGATTGGAAGTATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145442
VALIDATED
MBIP MISSION shRNA shRNA Plasmid DNA
MAP3K12 binding inhibitory protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145442.1-1146s1c1
Sequence:CCGGGCTTAACTATTTGCAGTGTATCTCGAGATACACTGCAAATAGTTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145442.1-298s1c1
Sequence:CCGGCTGCACTTGAACAACACGTTTCTCGAGAAACGTGTTGTTCAAGTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145442.1-942s1c1
Sequence:CCGGCCTGAATACTTCCAATCTGTACTCGAGTACAGATTGGAAGTATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145442.1-869s1c1
Sequence:CCGGCCCAGTACCAAGAGACATCTACTCGAGTAGATGTCTCTTGGTACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145442.1-399s1c1
Sequence:CCGGGCAGAGACCAAGAGTGAACTACTCGAGTAGTTCACTCTTGGTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145442.1-1146s21c1
Sequence:CCGGGCTTAACTATTTGCAGTGTATCTCGAGATACACTGCAAATAGTTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145442.1-399s21c1
Sequence:CCGGGCAGAGACCAAGAGTGAACTACTCGAGTAGTTCACTCTTGGTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145442.1-298s21c1
Sequence:CCGGCTGCACTTGAACAACACGTTTCTCGAGAAACGTGTTGTTCAAGTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145442.1-942s21c1
Sequence:CCGGCCTGAATACTTCCAATCTGTACTCGAGTACAGATTGGAAGTATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145442
VALIDATED
MBIP MISSION shRNA Lentiviral Transduction Particles
MAP3K12 binding inhibitory protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145442.1-1146s1c1
Sequence:CCGGGCTTAACTATTTGCAGTGTATCTCGAGATACACTGCAAATAGTTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145442.1-298s1c1
Sequence:CCGGCTGCACTTGAACAACACGTTTCTCGAGAAACGTGTTGTTCAAGTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145442.1-942s1c1
Sequence:CCGGCCTGAATACTTCCAATCTGTACTCGAGTACAGATTGGAAGTATTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145442.1-869s1c1
Sequence:CCGGCCCAGTACCAAGAGACATCTACTCGAGTAGATGTCTCTTGGTACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145442.1-399s1c1
Sequence:CCGGGCAGAGACCAAGAGTGAACTACTCGAGTAGTTCACTCTTGGTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145442.1-1146s21c1
Sequence:CCGGGCTTAACTATTTGCAGTGTATCTCGAGATACACTGCAAATAGTTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145442.1-399s21c1
Sequence:CCGGGCAGAGACCAAGAGTGAACTACTCGAGTAGTTCACTCTTGGTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145442.1-298s21c1
Sequence:CCGGCTGCACTTGAACAACACGTTTCTCGAGAAACGTGTTGTTCAAGTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145442.1-942s21c1
Sequence:CCGGCCTGAATACTTCCAATCTGTACTCGAGTACAGATTGGAAGTATTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016586
VALIDATED
MBIP MISSION shRNA Bacterial Glycerol Stock
MAP3K12 binding inhibitory protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_016586.x-860s1c1
Sequence:CCGGCAAGAGACATTTATCAGAGAACTCGAGTTCTCTGATAAATGTCTCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_016586.x-353s1c1
Sequence:CCGGCTGCTGTTGAAGAGATAGGAACTCGAGTTCCTATCTCTTCAACAGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_016586.x-853s1c1
Sequence:CCGGCCAGTGCCAAGAGACATTTATCTCGAGATAAATGTCTCTTGGCACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_016586.x-1388s1c1
Sequence:CCGGCCACCGGAAGGAAGATTTATTCTCGAGAATAAATCTTCCTTCCGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_016586.x-997s1c1
Sequence:CCGGCTGGCTGAACTTGATGAGAAACTCGAGTTTCTCATCAAGTTCAGCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231626    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_016586.1-1416s21c1
Sequence:CCGGTGATACTTTAAACGGACTTTACTCGAGTAAAGTCCGTTTAAAGTATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_016586.1-853s21c1
Sequence:CCGGCCAGTGCCAAGAGACATTTATCTCGAGATAAATGTCTCTTGGCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_016586.1-743s21c1
Sequence:CCGGTTCCAGGGTCAGGTCATAAACCTCGAGGTTTATGACCTGACCCTGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_016586.1-638s21c1
Sequence:CCGGGTGCAAGAACTGATGCGATTTCTCGAGAAATCGCATCAGTTCTTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_016586.1-528s21c1
Sequence:CCGGAGAAATTGACAGACGAATATCCTCGAGGATATTCGTCTGTCAATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016586
VALIDATED
MBIP MISSION shRNA shRNA Plasmid DNA
MAP3K12 binding inhibitory protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_016586.x-860s1c1
Sequence:CCGGCAAGAGACATTTATCAGAGAACTCGAGTTCTCTGATAAATGTCTCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_016586.x-353s1c1
Sequence:CCGGCTGCTGTTGAAGAGATAGGAACTCGAGTTCCTATCTCTTCAACAGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_016586.x-853s1c1
Sequence:CCGGCCAGTGCCAAGAGACATTTATCTCGAGATAAATGTCTCTTGGCACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_016586.x-1388s1c1
Sequence:CCGGCCACCGGAAGGAAGATTTATTCTCGAGAATAAATCTTCCTTCCGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_016586.x-997s1c1
Sequence:CCGGCTGGCTGAACTTGATGAGAAACTCGAGTTTCTCATCAAGTTCAGCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231626    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_016586.1-1416s21c1
Sequence:CCGGTGATACTTTAAACGGACTTTACTCGAGTAAAGTCCGTTTAAAGTATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_016586.1-853s21c1
Sequence:CCGGCCAGTGCCAAGAGACATTTATCTCGAGATAAATGTCTCTTGGCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_016586.1-743s21c1
Sequence:CCGGTTCCAGGGTCAGGTCATAAACCTCGAGGTTTATGACCTGACCCTGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_016586.1-638s21c1
Sequence:CCGGGTGCAAGAACTGATGCGATTTCTCGAGAAATCGCATCAGTTCTTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_016586.1-528s21c1
Sequence:CCGGAGAAATTGACAGACGAATATCCTCGAGGATATTCGTCTGTCAATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016586
VALIDATED
MBIP MISSION shRNA Lentiviral Transduction Particles
MAP3K12 binding inhibitory protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_016586.x-860s1c1
Sequence:CCGGCAAGAGACATTTATCAGAGAACTCGAGTTCTCTGATAAATGTCTCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_016586.x-353s1c1
Sequence:CCGGCTGCTGTTGAAGAGATAGGAACTCGAGTTCCTATCTCTTCAACAGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_016586.x-853s1c1
Sequence:CCGGCCAGTGCCAAGAGACATTTATCTCGAGATAAATGTCTCTTGGCACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_016586.x-1388s1c1
Sequence:CCGGCCACCGGAAGGAAGATTTATTCTCGAGAATAAATCTTCCTTCCGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_016586.x-997s1c1
Sequence:CCGGCTGGCTGAACTTGATGAGAAACTCGAGTTTCTCATCAAGTTCAGCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231626    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_016586.1-1416s21c1
Sequence:CCGGTGATACTTTAAACGGACTTTACTCGAGTAAAGTCCGTTTAAAGTATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_016586.1-853s21c1
Sequence:CCGGCCAGTGCCAAGAGACATTTATCTCGAGATAAATGTCTCTTGGCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_016586.1-743s21c1
Sequence:CCGGTTCCAGGGTCAGGTCATAAACCTCGAGGTTTATGACCTGACCCTGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_016586.1-638s21c1
Sequence:CCGGGTGCAAGAACTGATGCGATTTCTCGAGAAATCGCATCAGTTCTTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_016586.1-528s21c1
Sequence:CCGGAGAAATTGACAGACGAATATCCTCGAGGATATTCGTCTGTCAATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)