EMAIL THIS PAGE TO A FRIEND

MBL2

mannose-binding lectin (protein C) 2, soluble

81 Gene Product Result for
Synonyms: COLEC1 HSMBPC MBL MBL2D MBP MBP-C MBP1 MBPD
Gene ID:
Human(4153) Summary: This gene encodes the soluble mannose-binding lectin or mannose-binding protein found in serum. The protein encoded belongs to the collectin family and is an important element in the innate immune system. The protein recognizes mannose and N-acetylglucosamine on many microorganisms, and is capable of activating the classical complement pathway. Deficiencies of this gene have been associated with susceptibility to autoimmune and infectious diseases. [provided by RefSeq, Jul 2008]
Mouse(17195) mannose-binding lectin (protein C) 2
Rat(64668) mannose-binding lectin (protein C) 2
chicken(374267) mannose-binding lectin (protein C) 2, soluble
cow(281297) mannose-binding lectin (protein C) 2, soluble
Horse(100034103) mannose-binding lectin (protein C) 2, soluble
domestic guinea pig(100732862) mannose-binding lectin (protein C) 2, soluble
sheep(101116362) mannose-binding lectin (protein C) 2, soluble
sheep(100302094) mannose-binding lectin (protein C) 2, soluble
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010776 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010776 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010776 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000242 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000242 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000242 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041811 MISSION® esiRNA esiRNA human MBL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000242 Rosetta Predictions human pricing
NM_022704 Rosetta Predictions rat pricing
NM_010776 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083555 predicted 217
2 SASI_Hs01_00083556 predicted 683
3 SASI_Hs01_00083557 predicted 520
4 SASI_Hs01_00083558 predicted 706
5 SASI_Hs01_00083559 predicted 635
6 SASI_Hs01_00083560 predicted 697
7 SASI_Hs01_00083561 predicted 565
8 SASI_Hs01_00083562 predicted 512
9 SASI_Hs01_00083563 predicted 473
10 SASI_Hs01_00083564 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022704 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263515 predicted 369
2 SASI_Rn02_00263516 predicted 618
3 SASI_Rn01_00097810 predicted 526
4 SASI_Rn02_00263517 predicted 340
5 SASI_Rn02_00263518 predicted 516
6 SASI_Rn02_00263519 predicted 373
7 SASI_Rn02_00263520 predicted 618
8 SASI_Rn02_00263521 predicted 543
9 SASI_Rn02_00263522 predicted 597
10 SASI_Rn02_00263523 predicted 293
11 SASI_Rn01_00097807 predicted 514
12 SASI_Rn01_00097808 predicted 259
13 SASI_Rn01_00097809 predicted 459
14 SASI_Rn01_00097811 predicted 486
15 SASI_Rn01_00097812 predicted 225
16 SASI_Rn01_00097813 predicted 488
17 SASI_Rn01_00097814 predicted 687
18 SASI_Rn01_00097815 predicted 782
19 SASI_Rn01_00097816 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010776 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155973 predicted 364
2 SASI_Mm01_00155975 predicted 458
3 SASI_Mm01_00155976 predicted 819
4 SASI_Mm01_00155977 predicted 701
5 SASI_Mm01_00155978 predicted 213
6 SASI_Mm02_00319325 predicted 218
7 SASI_Mm01_00155979 predicted 685
8 SASI_Mm01_00155980 predicted 233
9 SASI_Mm01_00155981 predicted 821
10 SASI_Mm01_00155982 predicted 693
11 SASI_Mm01_00155974 predicted 831
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010776
MBL2 MISSION shRNA Bacterial Glycerol Stock
mannose-binding lectin (protein C) 2, soluble
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010776.1-220s1c1
Sequence:CCGGTGGTTTATGCAGAGACCTTAACTCGAGTTAAGGTCTCTGCATAAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010776.1-774s1c1
Sequence:CCGGCGCTATACTAATTGGAATGATCTCGAGATCATTCCAATTAGTATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010776.1-465s1c1
Sequence:CCGGGCAGAATTTGATACTAGCGAACTCGAGTTCGCTAGTATCAAATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010776.1-235s1c1
Sequence:CCGGCCTTAACCGAAGGTGTTCAAACTCGAGTTTGAACACCTTCGGTTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010776.1-771s1c1
Sequence:CCGGGTGCGCTATACTAATTGGAATCTCGAGATTCCAATTAGTATAGCGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010776
MBL2 MISSION shRNA shRNA Plasmid DNA
mannose-binding lectin (protein C) 2, soluble
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010776.1-220s1c1
Sequence:CCGGTGGTTTATGCAGAGACCTTAACTCGAGTTAAGGTCTCTGCATAAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010776.1-774s1c1
Sequence:CCGGCGCTATACTAATTGGAATGATCTCGAGATCATTCCAATTAGTATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010776.1-465s1c1
Sequence:CCGGGCAGAATTTGATACTAGCGAACTCGAGTTCGCTAGTATCAAATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010776.1-235s1c1
Sequence:CCGGCCTTAACCGAAGGTGTTCAAACTCGAGTTTGAACACCTTCGGTTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010776.1-771s1c1
Sequence:CCGGGTGCGCTATACTAATTGGAATCTCGAGATTCCAATTAGTATAGCGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010776
MBL2 MISSION shRNA Lentiviral Transduction Particles
mannose-binding lectin (protein C) 2, soluble
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010776.1-220s1c1
Sequence:CCGGTGGTTTATGCAGAGACCTTAACTCGAGTTAAGGTCTCTGCATAAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010776.1-774s1c1
Sequence:CCGGCGCTATACTAATTGGAATGATCTCGAGATCATTCCAATTAGTATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010776.1-465s1c1
Sequence:CCGGGCAGAATTTGATACTAGCGAACTCGAGTTCGCTAGTATCAAATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010776.1-235s1c1
Sequence:CCGGCCTTAACCGAAGGTGTTCAAACTCGAGTTTGAACACCTTCGGTTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010776.1-771s1c1
Sequence:CCGGGTGCGCTATACTAATTGGAATCTCGAGATTCCAATTAGTATAGCGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000242
MBL2 MISSION shRNA Bacterial Glycerol Stock
mannose-binding lectin (protein C) 2, soluble
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000242.1-715s1c1
Sequence:CCGGGTTCTGATGAAGATTGTGTATCTCGAGATACACAATCTTCATCAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000242.1-410s1c1
Sequence:CCGGGCAAACAGAAATGGCACGTATCTCGAGATACGTGCCATTTCTGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000242.1-659s1c1
Sequence:CCGGGACAGGAAATAGACTGACCTACTCGAGTAGGTCAGTCTATTTCCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000242.1-482s1c1
Sequence:CCGGCCTGACCAATGGTGAAATAATCTCGAGATTATTTCACCATTGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000242.1-111s1c1
Sequence:CCGGGCAGCGTCTTACTCAGAAACTCTCGAGAGTTTCTGAGTAAGACGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000242.2-802s21c1
Sequence:CCCGTCCCTATCTGAAGGGTCATATCTCGAGATATGACCCTTCAGATAGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000242.2-998s21c1
Sequence:CCGGAGTAGTAGTCATGCTAATTATCTCGAGATAATTAGCATGACTACTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000242
MBL2 MISSION shRNA shRNA Plasmid DNA
mannose-binding lectin (protein C) 2, soluble
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000242.1-715s1c1
Sequence:CCGGGTTCTGATGAAGATTGTGTATCTCGAGATACACAATCTTCATCAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000242.1-410s1c1
Sequence:CCGGGCAAACAGAAATGGCACGTATCTCGAGATACGTGCCATTTCTGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000242.1-659s1c1
Sequence:CCGGGACAGGAAATAGACTGACCTACTCGAGTAGGTCAGTCTATTTCCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000242.1-482s1c1
Sequence:CCGGCCTGACCAATGGTGAAATAATCTCGAGATTATTTCACCATTGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000242.1-111s1c1
Sequence:CCGGGCAGCGTCTTACTCAGAAACTCTCGAGAGTTTCTGAGTAAGACGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000242.2-802s21c1
Sequence:CCCGTCCCTATCTGAAGGGTCATATCTCGAGATATGACCCTTCAGATAGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000242.2-998s21c1
Sequence:CCGGAGTAGTAGTCATGCTAATTATCTCGAGATAATTAGCATGACTACTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000242
MBL2 MISSION shRNA Lentiviral Transduction Particles
mannose-binding lectin (protein C) 2, soluble
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000242.1-715s1c1
Sequence:CCGGGTTCTGATGAAGATTGTGTATCTCGAGATACACAATCTTCATCAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000242.1-410s1c1
Sequence:CCGGGCAAACAGAAATGGCACGTATCTCGAGATACGTGCCATTTCTGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000242.1-659s1c1
Sequence:CCGGGACAGGAAATAGACTGACCTACTCGAGTAGGTCAGTCTATTTCCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000242.1-482s1c1
Sequence:CCGGCCTGACCAATGGTGAAATAATCTCGAGATTATTTCACCATTGGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000242.1-111s1c1
Sequence:CCGGGCAGCGTCTTACTCAGAAACTCTCGAGAGTTTCTGAGTAAGACGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000242.2-802s21c1
Sequence:CCCGTCCCTATCTGAAGGGTCATATCTCGAGATATGACCCTTCAGATAGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000242.2-998s21c1
Sequence:CCGGAGTAGTAGTCATGCTAATTATCTCGAGATAATTAGCATGACTACTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)