EMAIL THIS PAGE TO A FRIEND

MBLAC1

metallo-beta-lactamase domain containing 1

46 Gene Product Result for
UniProtKB ID: A4D2B0, Q8N5X8
Gene ID:
Mouse(330216) metallo-beta-lactamase domain containing 1
Rat(304346) metallo-beta-lactamase domain containing 1
chicken(100858783) metallo-beta-lactamase domain containing 1
dog(608590) metallo-beta-lactamase domain containing 1
domestic cat(101089412) metallo-beta-lactamase domain containing 1
cow(505636) metallo-beta-lactamase domain containing 1
sheep(101107250) metallo-beta-lactamase domain containing 1
domestic guinea pig(100718769) metallo-beta-lactamase domain containing 1
naked mole-rat(101724023) metallo-beta-lactamase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203397 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203397 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203397 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177878 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177878 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177878 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU033891 MISSION® esiRNA esiRNA targeting mouse BC038925 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203397 Rosetta Predictions human pricing
NM_001024996 Rosetta Predictions rat pricing
NM_177878 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241518 predicted 781
2 SASI_Hs02_00373327 predicted 1243
3 SASI_Hs02_00373328 predicted 1235
4 SASI_Hs02_00373329 predicted 1256
5 SASI_Hs01_00241521 predicted 797
6 SASI_Hs02_00373330 predicted 747
7 SASI_Hs01_00241522 predicted 1186
8 SASI_Hs01_00241523 predicted 1044
9 SASI_Hs01_00241525 predicted 1260
10 SASI_Hs01_00241526 predicted 1273
11 SASI_Hs01_00241519 predicted 967
12 SASI_Hs01_00241520 predicted 1229
13 SASI_Hs01_00241524 predicted 969
14 SASI_Hs01_00241527 predicted 1100
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024996 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112195 predicted 494
2 SASI_Rn01_00112196 predicted 986
3 SASI_Rn01_00112197 predicted 1004
4 SASI_Rn01_00112198 predicted 928
5 SASI_Rn01_00112199 predicted 858
6 SASI_Rn01_00112200 predicted 677
7 SASI_Rn01_00112201 predicted 993
8 SASI_Rn01_00112202 predicted 897
9 SASI_Rn01_00112203 predicted 668
10 SASI_Rn01_00112204 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177878 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133259 predicted 749
2 SASI_Mm01_00133260 predicted 534
3 SASI_Mm01_00133261 predicted 823
4 SASI_Mm01_00133262 predicted 481
5 SASI_Mm01_00133265 predicted 742
6 SASI_Mm01_00133266 predicted 792
7 SASI_Mm01_00133267 predicted 664
8 SASI_Mm01_00133268 predicted 671
9 SASI_Mm02_00348360 predicted 473
10 SASI_Mm02_00348361 predicted 441
11 SASI_Mm01_00133263 predicted 807
12 SASI_Mm01_00133264 predicted 837
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203397
MBLAC1 MISSION shRNA Bacterial Glycerol Stock
metallo-beta-lactamase domain containing 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000268460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203397.1-1100s21c1
Sequence:CCGGCCTTTCGAGTGTTAAGGGAAGCTCGAGCTTCCCTTAACACTCGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203397.1-789s21c1
Sequence:CCGGTCTGCTGGTCTCGCACGACTTCTCGAGAAGTCGTGCGAGACCAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203397.1-1345s21c1
Sequence:CCGGTGCCATCACATCGTCAGTATCCTCGAGGATACTGACGATGTGATGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203397.1-747s21c1
Sequence:CCGGCTCGGATCACATCGGGAACTTCTCGAGAAGTTCCCGATGTGATCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203397
MBLAC1 MISSION shRNA shRNA Plasmid DNA
metallo-beta-lactamase domain containing 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000268460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203397.1-1100s21c1
Sequence:CCGGCCTTTCGAGTGTTAAGGGAAGCTCGAGCTTCCCTTAACACTCGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203397.1-789s21c1
Sequence:CCGGTCTGCTGGTCTCGCACGACTTCTCGAGAAGTCGTGCGAGACCAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203397.1-1345s21c1
Sequence:CCGGTGCCATCACATCGTCAGTATCCTCGAGGATACTGACGATGTGATGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203397.1-747s21c1
Sequence:CCGGCTCGGATCACATCGGGAACTTCTCGAGAAGTTCCCGATGTGATCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203397
MBLAC1 MISSION shRNA Lentiviral Transduction Particles
metallo-beta-lactamase domain containing 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000268460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203397.1-1100s21c1
Sequence:CCGGCCTTTCGAGTGTTAAGGGAAGCTCGAGCTTCCCTTAACACTCGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203397.1-789s21c1
Sequence:CCGGTCTGCTGGTCTCGCACGACTTCTCGAGAAGTCGTGCGAGACCAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203397.1-1345s21c1
Sequence:CCGGTGCCATCACATCGTCAGTATCCTCGAGGATACTGACGATGTGATGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203397.1-747s21c1
Sequence:CCGGCTCGGATCACATCGGGAACTTCTCGAGAAGTTCCCGATGTGATCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177878
MBLAC1 MISSION shRNA Bacterial Glycerol Stock
metallo-beta-lactamase domain containing 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177878.2-913s21c1
Sequence:CCGGAGTTGGTCCGGGAGACCTAGACTCGAGTCTAGGTCTCCCGGACCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177878.2-800s21c1
Sequence:CCGGTTCGAGTGGTCAGGGAAACAGCTCGAGCTGTTTCCCTGACCACTCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177878.2-545s21c1
Sequence:CCGGGTGAAACGCAGCCCTTGATACCTCGAGGTATCAAGGGCTGCGTTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177878.2-437s21c1
Sequence:CCGGACGGACACTCGGATCATATTGCTCGAGCAATATGATCCGAGTGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177878.2-473s21c1
Sequence:CCGGTTCCCGAGGCAGCTTTGTTAGCTCGAGCTAACAAAGCTGCCTCGGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177878.1-482s1c1
Sequence:CCGGGCAGCTTTGTTAGTCTCCCATCTCGAGATGGGAGACTAACAAAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177878
MBLAC1 MISSION shRNA shRNA Plasmid DNA
metallo-beta-lactamase domain containing 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177878.2-913s21c1
Sequence:CCGGAGTTGGTCCGGGAGACCTAGACTCGAGTCTAGGTCTCCCGGACCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177878.2-800s21c1
Sequence:CCGGTTCGAGTGGTCAGGGAAACAGCTCGAGCTGTTTCCCTGACCACTCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177878.2-545s21c1
Sequence:CCGGGTGAAACGCAGCCCTTGATACCTCGAGGTATCAAGGGCTGCGTTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177878.2-437s21c1
Sequence:CCGGACGGACACTCGGATCATATTGCTCGAGCAATATGATCCGAGTGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177878.2-473s21c1
Sequence:CCGGTTCCCGAGGCAGCTTTGTTAGCTCGAGCTAACAAAGCTGCCTCGGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177878.1-482s1c1
Sequence:CCGGGCAGCTTTGTTAGTCTCCCATCTCGAGATGGGAGACTAACAAAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177878
MBLAC1 MISSION shRNA Lentiviral Transduction Particles
metallo-beta-lactamase domain containing 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177878.2-913s21c1
Sequence:CCGGAGTTGGTCCGGGAGACCTAGACTCGAGTCTAGGTCTCCCGGACCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177878.2-800s21c1
Sequence:CCGGTTCGAGTGGTCAGGGAAACAGCTCGAGCTGTTTCCCTGACCACTCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177878.2-545s21c1
Sequence:CCGGGTGAAACGCAGCCCTTGATACCTCGAGGTATCAAGGGCTGCGTTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177878.2-437s21c1
Sequence:CCGGACGGACACTCGGATCATATTGCTCGAGCAATATGATCCGAGTGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177878.2-473s21c1
Sequence:CCGGTTCCCGAGGCAGCTTTGTTAGCTCGAGCTAACAAAGCTGCCTCGGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177878.1-482s1c1
Sequence:CCGGGCAGCTTTGTTAGTCTCCCATCTCGAGATGGGAGACTAACAAAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)