EMAIL THIS PAGE TO A FRIEND

MBLAC2

metallo-beta-lactamase domain containing 2

46 Gene Product Result for
UniProtKB ID: Q68D91, D6RJI1, Q8IY16, Q8N8D8
Gene ID:
Mouse(72852) metallo-beta-lactamase domain containing 2
Rat(365627) metallo-beta-lactamase domain containing 2
naked mole-rat(101721674) metallo-beta-lactamase domain containing 2
domestic guinea pig(100724528) metallo-beta-lactamase domain containing 2
sheep(101120494) metallo-beta-lactamase domain containing 2
Zebrafish(563823) metallo-beta-lactamase domain containing 2
chicken(431565) metallo-beta-lactamase domain containing 2
cow(537692) metallo-beta-lactamase domain containing 2
dog(488914) metallo-beta-lactamase domain containing 2
domestic cat(101098923) metallo-beta-lactamase domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028372 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028372 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028372 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_203406 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203406 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203406 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203406 Rosetta Predictions human pricing
NM_001108934 Rosetta Predictions rat pricing
NM_028372 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203406 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018344 predicted 1220
2 SASI_Hs01_00018345 predicted 1100
3 SASI_Hs01_00018346 predicted 1043
4 SASI_Hs01_00018347 predicted 1073
5 SASI_Hs01_00018348 predicted 989
6 SASI_Hs01_00018349 predicted 1377
7 SASI_Hs02_00373336 predicted 991
8 SASI_Hs01_00018350 predicted 1360
9 SASI_Hs01_00018351 predicted 1358
10 SASI_Hs01_00018352 predicted 1315
11 SASI_Hs01_00018353 predicted 1103
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108934 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243524 predicted 748
2 SASI_Rn02_00243525 predicted 549
3 SASI_Rn02_00243526 predicted 749
4 SASI_Rn02_00243527 predicted 745
5 SASI_Rn02_00243528 predicted 551
6 SASI_Rn02_00243529 predicted 672
7 SASI_Rn02_00243530 predicted 634
8 SASI_Rn02_00243531 predicted 815
9 SASI_Rn02_00243532 predicted 787
10 SASI_Rn02_00243533 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028372 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179422 predicted 723
2 SASI_Mm01_00179423 predicted 624
3 SASI_Mm01_00179424 predicted 673
4 SASI_Mm01_00179425 predicted 584
5 SASI_Mm01_00179426 predicted 820
6 SASI_Mm01_00179427 predicted 711
7 SASI_Mm02_00333744 predicted 762
8 SASI_Mm01_00179428 predicted 825
9 SASI_Mm01_00179429 predicted 300
10 SASI_Mm01_00179430 predicted 608
11 SASI_Mm01_00179421 predicted 869
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028372
MBLAC2 MISSION shRNA Bacterial Glycerol Stock
metallo-beta-lactamase domain containing 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028372.1-2731s21c1
Sequence:CCGGTATTCCTTGCGACCGTATAAACTCGAGTTTATACGGTCGCAAGGAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028372.1-834s21c1
Sequence:CCGGTTCGCTTAGCTTCTAACTATACTCGAGTATAGTTAGAAGCTAAGCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028372.1-170s1c1
Sequence:CCGGCAAGAACGGTTCTACGAGTCACTCGAGTGACTCGTAGAACCGTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028372.1-639s1c1
Sequence:CCGGGCTTACATGATAAAGACCGTACTCGAGTACGGTCTTTATCATGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028372.1-586s1c1
Sequence:CCGGCGACAGACAGCTCACTGTTATCTCGAGATAACAGTGAGCTGTCTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028372.1-1426s1c1
Sequence:CCGGCTCAACGTAAACTAGCATTTACTCGAGTAAATGCTAGTTTACGTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028372.1-950s21c1
Sequence:CCGGTAGTATCTACACTGGTCATTTCTCGAGAAATGACCAGTGTAGATACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028372.1-299s21c1
Sequence:CCGGTTGCAGGATTGCGGGTCTAAACTCGAGTTTAGACCCGCAATCCTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028372
MBLAC2 MISSION shRNA shRNA Plasmid DNA
metallo-beta-lactamase domain containing 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028372.1-2731s21c1
Sequence:CCGGTATTCCTTGCGACCGTATAAACTCGAGTTTATACGGTCGCAAGGAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028372.1-834s21c1
Sequence:CCGGTTCGCTTAGCTTCTAACTATACTCGAGTATAGTTAGAAGCTAAGCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028372.1-170s1c1
Sequence:CCGGCAAGAACGGTTCTACGAGTCACTCGAGTGACTCGTAGAACCGTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028372.1-639s1c1
Sequence:CCGGGCTTACATGATAAAGACCGTACTCGAGTACGGTCTTTATCATGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028372.1-586s1c1
Sequence:CCGGCGACAGACAGCTCACTGTTATCTCGAGATAACAGTGAGCTGTCTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028372.1-1426s1c1
Sequence:CCGGCTCAACGTAAACTAGCATTTACTCGAGTAAATGCTAGTTTACGTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028372.1-950s21c1
Sequence:CCGGTAGTATCTACACTGGTCATTTCTCGAGAAATGACCAGTGTAGATACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028372.1-299s21c1
Sequence:CCGGTTGCAGGATTGCGGGTCTAAACTCGAGTTTAGACCCGCAATCCTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028372
MBLAC2 MISSION shRNA Lentiviral Transduction Particles
metallo-beta-lactamase domain containing 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028372.1-2731s21c1
Sequence:CCGGTATTCCTTGCGACCGTATAAACTCGAGTTTATACGGTCGCAAGGAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028372.1-834s21c1
Sequence:CCGGTTCGCTTAGCTTCTAACTATACTCGAGTATAGTTAGAAGCTAAGCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028372.1-170s1c1
Sequence:CCGGCAAGAACGGTTCTACGAGTCACTCGAGTGACTCGTAGAACCGTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028372.1-639s1c1
Sequence:CCGGGCTTACATGATAAAGACCGTACTCGAGTACGGTCTTTATCATGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028372.1-586s1c1
Sequence:CCGGCGACAGACAGCTCACTGTTATCTCGAGATAACAGTGAGCTGTCTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028372.1-1426s1c1
Sequence:CCGGCTCAACGTAAACTAGCATTTACTCGAGTAAATGCTAGTTTACGTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028372.1-950s21c1
Sequence:CCGGTAGTATCTACACTGGTCATTTCTCGAGAAATGACCAGTGTAGATACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028372.1-299s21c1
Sequence:CCGGTTGCAGGATTGCGGGTCTAAACTCGAGTTTAGACCCGCAATCCTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203406
VALIDATED
MBLAC2 MISSION shRNA Bacterial Glycerol Stock
metallo-beta-lactamase domain containing 2
Human
20 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203406.1-1161s1c1
Sequence:CCGGCCTGGGCACTTCAATACCTTTCTCGAGAAAGGTATTGAAGTGCCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203406.1-1020s1c1
Sequence:CCGGCGAAAGATTCTCTTCAGTGGACTCGAGTCCACTGAAGAGAATCTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203406.1-524s1c1
Sequence:CCGGCTTCTGGATTCAAGAACGTTTCTCGAGAAACGTTCTTGAATCCAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133757    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_203406.1-3588s1c1
Sequence:CCGGCCACAACATAGAACTGTGATACTCGAGTATCACAGTTCTATGTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203406.1-1004s1c1
Sequence:CCGGCTTACATGACAAAGACCGAAACTCGAGTTTCGGTCTTTGTCATGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203406.1-2178s1c1
Sequence:CCGGGCGACTTCAGTATTGTGTTATCTCGAGATAACACAATACTGAAGTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203406.1-1304s21c1
Sequence:CCGGGACCTCGCCCTAGTATCTATACTCGAGTATAGATACTAGGGCGAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203406.1-1103s21c1
Sequence:CCGGTGGAACTTGTGAACGTCTAATCTCGAGATTAGACGTTCACAAGTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203406.1-1133s21c1
Sequence:CCGGGGACAGAGGTCTGGTAGAGAACTCGAGTTCTCTACCAGACCTCTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133936    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_203406.1-4131s1c1
Sequence:CCGGCCTTGTGTGTTATCCTGATATCTCGAGATATCAGGATAACACACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_203406.1-1528s1c1
Sequence:CCGGGCCAAAGCTGTCATCTTGTAACTCGAGTTACAAGATGACAGCTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203406.1-1050s21c1
Sequence:CCGGTATGATGGATCACTGATTGACCTCGAGGTCAATCAGTGATCCATCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203406.1-1272s1c1
Sequence:CCGGGCAAGTTTAGCTCTACGTGTACTCGAGTACACGTAGAGCTAAACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_203406.1-1273s1c1
Sequence:CCGGCAAGTTTAGCTCTACGTGTAACTCGAGTTACACGTAGAGCTAAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_203406.1-1003s1c1
Sequence:CCGGGCTTACATGACAAAGACCGAACTCGAGTTCGGTCTTTGTCATGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203406.1-506s21c1
Sequence:CCGGGTCTCTAGGCGATGGTATCTTCTCGAGAAGATACCATCGCCTAGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203406.1-592s21c1
Sequence:CCGGAGCAGGACGTGGTGATCGATACTCGAGTATCGATCACCACGTCCTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203406.1-1229s21c1
Sequence:CCGGTGGGATATGTCACAAAGTTTCCTCGAGGAAACTTTGTGACATATCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203406.1-950s21c1
Sequence:CCGGTGACAGACAGCTCACTGTTATCTCGAGATAACAGTGAGCTGTCTGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203406.1-1493s21c1
Sequence:CCGGCCAAGAAAGAAGCCACTTAAACTCGAGTTTAAGTGGCTTCTTTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203406
VALIDATED
MBLAC2 MISSION shRNA shRNA Plasmid DNA
metallo-beta-lactamase domain containing 2
Human
20 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203406.1-1161s1c1
Sequence:CCGGCCTGGGCACTTCAATACCTTTCTCGAGAAAGGTATTGAAGTGCCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203406.1-1020s1c1
Sequence:CCGGCGAAAGATTCTCTTCAGTGGACTCGAGTCCACTGAAGAGAATCTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203406.1-524s1c1
Sequence:CCGGCTTCTGGATTCAAGAACGTTTCTCGAGAAACGTTCTTGAATCCAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133757    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_203406.1-3588s1c1
Sequence:CCGGCCACAACATAGAACTGTGATACTCGAGTATCACAGTTCTATGTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203406.1-1004s1c1
Sequence:CCGGCTTACATGACAAAGACCGAAACTCGAGTTTCGGTCTTTGTCATGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203406.1-2178s1c1
Sequence:CCGGGCGACTTCAGTATTGTGTTATCTCGAGATAACACAATACTGAAGTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203406.1-1304s21c1
Sequence:CCGGGACCTCGCCCTAGTATCTATACTCGAGTATAGATACTAGGGCGAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203406.1-1103s21c1
Sequence:CCGGTGGAACTTGTGAACGTCTAATCTCGAGATTAGACGTTCACAAGTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203406.1-1133s21c1
Sequence:CCGGGGACAGAGGTCTGGTAGAGAACTCGAGTTCTCTACCAGACCTCTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133936    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_203406.1-4131s1c1
Sequence:CCGGCCTTGTGTGTTATCCTGATATCTCGAGATATCAGGATAACACACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_203406.1-1528s1c1
Sequence:CCGGGCCAAAGCTGTCATCTTGTAACTCGAGTTACAAGATGACAGCTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203406.1-1050s21c1
Sequence:CCGGTATGATGGATCACTGATTGACCTCGAGGTCAATCAGTGATCCATCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203406.1-1272s1c1
Sequence:CCGGGCAAGTTTAGCTCTACGTGTACTCGAGTACACGTAGAGCTAAACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_203406.1-1273s1c1
Sequence:CCGGCAAGTTTAGCTCTACGTGTAACTCGAGTTACACGTAGAGCTAAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_203406.1-1003s1c1
Sequence:CCGGGCTTACATGACAAAGACCGAACTCGAGTTCGGTCTTTGTCATGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203406.1-506s21c1
Sequence:CCGGGTCTCTAGGCGATGGTATCTTCTCGAGAAGATACCATCGCCTAGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203406.1-592s21c1
Sequence:CCGGAGCAGGACGTGGTGATCGATACTCGAGTATCGATCACCACGTCCTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203406.1-1229s21c1
Sequence:CCGGTGGGATATGTCACAAAGTTTCCTCGAGGAAACTTTGTGACATATCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203406.1-950s21c1
Sequence:CCGGTGACAGACAGCTCACTGTTATCTCGAGATAACAGTGAGCTGTCTGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203406.1-1493s21c1
Sequence:CCGGCCAAGAAAGAAGCCACTTAAACTCGAGTTTAAGTGGCTTCTTTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203406
VALIDATED
MBLAC2 MISSION shRNA Lentiviral Transduction Particles
metallo-beta-lactamase domain containing 2
Human
20 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203406.1-1161s1c1
Sequence:CCGGCCTGGGCACTTCAATACCTTTCTCGAGAAAGGTATTGAAGTGCCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203406.1-1020s1c1
Sequence:CCGGCGAAAGATTCTCTTCAGTGGACTCGAGTCCACTGAAGAGAATCTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203406.1-524s1c1
Sequence:CCGGCTTCTGGATTCAAGAACGTTTCTCGAGAAACGTTCTTGAATCCAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133757    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_203406.1-3588s1c1
Sequence:CCGGCCACAACATAGAACTGTGATACTCGAGTATCACAGTTCTATGTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203406.1-1004s1c1
Sequence:CCGGCTTACATGACAAAGACCGAAACTCGAGTTTCGGTCTTTGTCATGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203406.1-2178s1c1
Sequence:CCGGGCGACTTCAGTATTGTGTTATCTCGAGATAACACAATACTGAAGTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203406.1-1304s21c1
Sequence:CCGGGACCTCGCCCTAGTATCTATACTCGAGTATAGATACTAGGGCGAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203406.1-1103s21c1
Sequence:CCGGTGGAACTTGTGAACGTCTAATCTCGAGATTAGACGTTCACAAGTTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203406.1-1133s21c1
Sequence:CCGGGGACAGAGGTCTGGTAGAGAACTCGAGTTCTCTACCAGACCTCTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133936    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_203406.1-4131s1c1
Sequence:CCGGCCTTGTGTGTTATCCTGATATCTCGAGATATCAGGATAACACACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_203406.1-1528s1c1
Sequence:CCGGGCCAAAGCTGTCATCTTGTAACTCGAGTTACAAGATGACAGCTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203406.1-1050s21c1
Sequence:CCGGTATGATGGATCACTGATTGACCTCGAGGTCAATCAGTGATCCATCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203406.1-1272s1c1
Sequence:CCGGGCAAGTTTAGCTCTACGTGTACTCGAGTACACGTAGAGCTAAACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_203406.1-1273s1c1
Sequence:CCGGCAAGTTTAGCTCTACGTGTAACTCGAGTTACACGTAGAGCTAAACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_203406.1-1003s1c1
Sequence:CCGGGCTTACATGACAAAGACCGAACTCGAGTTCGGTCTTTGTCATGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203406.1-506s21c1
Sequence:CCGGGTCTCTAGGCGATGGTATCTTCTCGAGAAGATACCATCGCCTAGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203406.1-592s21c1
Sequence:CCGGAGCAGGACGTGGTGATCGATACTCGAGTATCGATCACCACGTCCTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203406.1-1229s21c1
Sequence:CCGGTGGGATATGTCACAAAGTTTCCTCGAGGAAACTTTGTGACATATCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203406.1-950s21c1
Sequence:CCGGTGACAGACAGCTCACTGTTATCTCGAGATAACAGTGAGCTGTCTGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203406.1-1493s21c1
Sequence:CCGGCCAAGAAAGAAGCCACTTAAACTCGAGTTTAAGTGGCTTCTTTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)