EMAIL THIS PAGE TO A FRIEND

MBNL1

muscleblind-like splicing regulator 1

291 Gene Product Result for
Synonyms: EXP EXP35 EXP40 EXP42 MBNL
Gene ID:
Mouse(56758) muscleblind-like 1 (Drosophila)
Rat(282635) muscleblind-like splicing regulator 1
Zebrafish(767696) muscleblind-like (Drosophila)
dog(477116) muscleblind-like splicing regulator 1
Horse(100050018) muscleblind-like splicing regulator 1
cow(781653) muscleblind-like splicing regulator 1
domestic cat(101091043) muscleblind-like splicing regulator 1
chicken(425033) muscleblind-like (Drosophila)
sheep(101114918) muscleblind-like splicing regulator 1
domestic guinea pig(100723020) muscleblind-like splicing regulator 1
naked mole-rat(101707864) muscleblind-like splicing regulator 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021038 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021038 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021038 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020007 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020007 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020007 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021038 Rosetta Predictions human pricing
NM_207292 Rosetta Predictions human pricing
NM_207293 Rosetta Predictions human pricing
NM_207294 Rosetta Predictions human pricing
NM_207295 Rosetta Predictions human pricing
NM_207296 Rosetta Predictions human pricing
NM_207297 Rosetta Predictions human pricing
XM_001062557 Rosetta Predictions rat pricing
XM_001075864 Rosetta Predictions rat pricing
XM_342252 Rosetta Predictions rat pricing
NM_020007 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021038 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354513 predicted 2872
2 SASI_Hs01_00232247 predicted 2998
3 SASI_Hs01_00232248 predicted 1842
4 SASI_Hs01_00232250 predicted 2292
5 SASI_Hs01_00232251 predicted 2166
6 SASI_Hs01_00232252 predicted 2075
7 SASI_Hs01_00232253 predicted 2718
8 SASI_Hs01_00232254 predicted 2826
9 SASI_Hs01_00232255 predicted 2677
10 SASI_Hs01_00232256 predicted 2076
11 SASI_Hs01_00232249 predicted 2393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086150 predicted 2840
2 SASI_Hs01_00086151 predicted 2959
3 SASI_Hs01_00086152 predicted 1841
4 SASI_Hs01_00086154 predicted 2299
5 SASI_Hs01_00086155 predicted 2164
6 SASI_Hs01_00086156 predicted 2072
7 SASI_Hs01_00086157 predicted 2716
8 SASI_Hs01_00086158 predicted 2680
9 SASI_Hs01_00086159 predicted 2075
10 SASI_Hs02_00373822 predicted 2719
11 SASI_Hs01_00086153 predicted 2390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207293 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373823 predicted 1842
2 SASI_Hs01_00185642 predicted 1961
3 SASI_Hs01_00185643 predicted 787
4 SASI_Hs01_00185645 predicted 1244
5 SASI_Hs01_00185646 predicted 1117
6 SASI_Hs01_00185647 predicted 1634
7 SASI_Hs01_00185648 predicted 1017
8 SASI_Hs01_00185649 predicted 1713
9 SASI_Hs01_00185650 predicted 1681
10 SASI_Hs01_00185651 predicted 1017
11 SASI_Hs01_00185644 predicted 1343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207294 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132519 predicted 1582
2 SASI_Hs01_00132520 predicted 1152
3 SASI_Hs01_00132521 predicted 1706
4 SASI_Hs01_00132522 predicted 788
5 SASI_Hs01_00132523 predicted 1199
6 SASI_Hs01_00132524 predicted 1017
7 SASI_Hs01_00132525 predicted 1456
8 SASI_Hs01_00132526 predicted 1423
9 SASI_Hs01_00132527 predicted 1018
10 SASI_Hs01_00132528 predicted 1461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207295 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213017 predicted 1614
2 SASI_Hs02_00373824 predicted 1149
3 SASI_Hs01_00213018 predicted 1735
4 SASI_Hs01_00213019 predicted 783
5 SASI_Hs01_00213020 predicted 1200
6 SASI_Hs01_00213021 predicted 1025
7 SASI_Hs01_00213022 predicted 1459
8 SASI_Hs01_00213023 predicted 1561
9 SASI_Hs01_00213024 predicted 1417
10 SASI_Hs01_00213025 predicted 1023
11 SASI_Hs01_00213026 predicted 1460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207296 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052178 predicted 1628
2 SASI_Hs01_00052179 predicted 1817
3 SASI_Hs01_00052180 predicted 792
4 SASI_Hs01_00052181 predicted 1336
5 SASI_Hs01_00052182 predicted 1241
6 SASI_Hs01_00052183 predicted 1405
7 SASI_Hs01_00052184 predicted 1116
8 SASI_Hs01_00052185 predicted 1025
9 SASI_Hs01_00052186 predicted 1019
10 SASI_Hs01_00052187 predicted 1327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207297 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081719 predicted 1851
2 SASI_Hs01_00081720 predicted 792
3 SASI_Hs01_00081722 predicted 1245
4 SASI_Hs01_00081723 predicted 1771
5 SASI_Hs02_00373825 predicted 1114
6 SASI_Hs01_00081724 predicted 1023
7 SASI_Hs01_00081725 predicted 1664
8 SASI_Hs01_00081726 predicted 1625
9 SASI_Hs01_00081727 predicted 1020
10 SASI_Hs01_00081728 predicted 1662
11 SASI_Hs01_00081721 predicted 1334
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062557 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00303827 predicted 549
2 SASI_Rn02_00303828 predicted 468
3 SASI_Rn02_00303829 predicted 969
4 SASI_Rn02_00303830 predicted 720
5 SASI_Rn02_00303831 predicted 1004
6 SASI_Rn02_00303832 predicted 1042
7 SASI_Rn02_00303833 predicted 1047
8 SASI_Rn02_00303834 predicted 293
9 SASI_Rn02_00303835 predicted 290
10 SASI_Rn02_00303836 predicted 1000
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075864 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351306 predicted 478
2 SASI_Rn02_00351307 predicted 541
3 SASI_Rn02_00351308 predicted 480
4 SASI_Rn02_00351309 predicted 466
5 SASI_Rn02_00351310 predicted 395
6 SASI_Rn02_00351311 predicted 295
7 SASI_Rn02_00351312 predicted 403
8 SASI_Rn02_00351313 predicted 200
9 SASI_Rn02_00351314 predicted 333
10 SASI_Rn02_00351315 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342252 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00178411 predicted 1157
2 SASI_Rn01_00178412 predicted 1634
3 SASI_Rn01_00178413 predicted 1563
4 SASI_Rn01_00178414 predicted 1623
5 SASI_Rn01_00178415 predicted 1337
6 SASI_Rn01_00178416 predicted 1666
7 SASI_Rn01_00178417 predicted 1705
8 SASI_Rn01_00178418 predicted 1372
9 SASI_Rn01_00178419 predicted 1708
10 SASI_Rn01_00178420 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020007 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086352 predicted 2253
2 SASI_Mm01_00086353 predicted 1982
3 SASI_Mm01_00086354 predicted 1848
4 SASI_Mm01_00086356 predicted 2138
5 SASI_Mm01_00086357 predicted 1913
6 SASI_Mm01_00086358 predicted 1965
7 SASI_Mm01_00086359 predicted 2028
8 SASI_Mm01_00086360 predicted 1330
9 SASI_Mm02_00325374 predicted 2268
10 SASI_Mm02_00325375 predicted 2258
11 SASI_Mm01_00086351 predicted 2228
12 SASI_Mm01_00086355 predicted 1677
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021038
MBNL1 MISSION shRNA Bacterial Glycerol Stock
muscleblind-like splicing regulator 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021038.3-2080s21c1
Sequence:CCGGGAGATAAATGGACGCAATAACCTCGAGGTTATTGCGTCCATTTATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021038.3-3046s21c1
Sequence:CCGGGAGTAAAGGACGAGGTCATTACTCGAGTAATGACCTCGTCCTTTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021038.3-3215s21c1
Sequence:CCGGATTTGTGCTGAGGTGATATTCCTCGAGGAATATCACCTCAGCACAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021038.3-2719s1c1
Sequence:CCGGGCAGTCTTTAACACTGGTATTCTCGAGAATACCAGTGTTAAAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021038.3-2302s1c1
Sequence:CCGGCCAATGTTGGTTACAGGGAATCTCGAGATTCCCTGTAACCAACATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021038.3-1996s1c1
Sequence:CCGGGCCTGCTTTGATTCATTGAAACTCGAGTTTCAATGAATCAAAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021038.3-2926s1c1
Sequence:CCGGGCCAACCAGATACCCATAATACTCGAGTATTATGGGTATCTGGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021038.3-2938s1c1
Sequence:CCGGCCCATAATATCTGCCGAACATCTCGAGATGTTCGGCAGATATTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021038
MBNL1 MISSION shRNA shRNA Plasmid DNA
muscleblind-like splicing regulator 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021038.3-2080s21c1
Sequence:CCGGGAGATAAATGGACGCAATAACCTCGAGGTTATTGCGTCCATTTATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021038.3-3046s21c1
Sequence:CCGGGAGTAAAGGACGAGGTCATTACTCGAGTAATGACCTCGTCCTTTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021038.3-3215s21c1
Sequence:CCGGATTTGTGCTGAGGTGATATTCCTCGAGGAATATCACCTCAGCACAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021038.3-2719s1c1
Sequence:CCGGGCAGTCTTTAACACTGGTATTCTCGAGAATACCAGTGTTAAAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021038.3-2302s1c1
Sequence:CCGGCCAATGTTGGTTACAGGGAATCTCGAGATTCCCTGTAACCAACATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021038.3-1996s1c1
Sequence:CCGGGCCTGCTTTGATTCATTGAAACTCGAGTTTCAATGAATCAAAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021038.3-2926s1c1
Sequence:CCGGGCCAACCAGATACCCATAATACTCGAGTATTATGGGTATCTGGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021038.3-2938s1c1
Sequence:CCGGCCCATAATATCTGCCGAACATCTCGAGATGTTCGGCAGATATTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021038
MBNL1 MISSION shRNA Lentiviral Transduction Particles
muscleblind-like splicing regulator 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021038.3-2080s21c1
Sequence:CCGGGAGATAAATGGACGCAATAACCTCGAGGTTATTGCGTCCATTTATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021038.3-3046s21c1
Sequence:CCGGGAGTAAAGGACGAGGTCATTACTCGAGTAATGACCTCGTCCTTTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021038.3-3215s21c1
Sequence:CCGGATTTGTGCTGAGGTGATATTCCTCGAGGAATATCACCTCAGCACAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021038.3-2719s1c1
Sequence:CCGGGCAGTCTTTAACACTGGTATTCTCGAGAATACCAGTGTTAAAGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021038.3-2302s1c1
Sequence:CCGGCCAATGTTGGTTACAGGGAATCTCGAGATTCCCTGTAACCAACATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021038.3-1996s1c1
Sequence:CCGGGCCTGCTTTGATTCATTGAAACTCGAGTTTCAATGAATCAAAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021038.3-2926s1c1
Sequence:CCGGGCCAACCAGATACCCATAATACTCGAGTATTATGGGTATCTGGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021038.3-2938s1c1
Sequence:CCGGCCCATAATATCTGCCGAACATCTCGAGATGTTCGGCAGATATTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020007
VALIDATED
MBNL1 MISSION shRNA Bacterial Glycerol Stock
muscleblind-like splicing regulator 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020007.3-1662s21c1
Sequence:GTACCGGTGACAGCACAATGATTGATACCTCGAGGTATCAATCATTGTGCTGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226192    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020007.3-5043s21c1
Sequence:CCGGCAGATCGATATCTACCAATTTCTCGAGAAATTGGTAGATATCGATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020007.3-2128s21c1
Sequence:CCGGGCCAACCAGATACCCATAATACTCGAGTATTATGGGTATCTGGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020007.3-1994s21c1
Sequence:CCGGTTCTCCCACCAGGCTCAATATCTCGAGATATTGAGCCTGGTGGGAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020007.3-1922s21c1
Sequence:CCGGCAGTCTTTAACACTGGTATTTCTCGAGAAATACCAGTGTTAAAGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020007.2-4754s1c1
Sequence:CCGGGCACAGAGTTAGCACTCCATACTCGAGTATGGAGTGCTAACTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020007.2-1100s1c1
Sequence:CCGGGAAGTATGTAGAGAGTTTCAACTCGAGTTGAAACTCTCTACATACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020007.2-2131s1c1
Sequence:CCGGAGCCAACCAGATACCCATAATCTCGAGATTATGGGTATCTGGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020007.2-1205s1c1
Sequence:CCGGGCCTGCTTTGATTCACTGAAACTCGAGTTTCAGTGAATCAAAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020007.2-1924s1c1
Sequence:CCGGCGCAGTCTTTAACACTGGTATCTCGAGATACCAGTGTTAAAGACTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020007
VALIDATED
MBNL1 MISSION shRNA shRNA Plasmid DNA
muscleblind-like splicing regulator 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020007.3-1662s21c1
Sequence:GTACCGGTGACAGCACAATGATTGATACCTCGAGGTATCAATCATTGTGCTGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226192    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020007.3-5043s21c1
Sequence:CCGGCAGATCGATATCTACCAATTTCTCGAGAAATTGGTAGATATCGATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020007.3-2128s21c1
Sequence:CCGGGCCAACCAGATACCCATAATACTCGAGTATTATGGGTATCTGGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020007.3-1994s21c1
Sequence:CCGGTTCTCCCACCAGGCTCAATATCTCGAGATATTGAGCCTGGTGGGAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020007.3-1922s21c1
Sequence:CCGGCAGTCTTTAACACTGGTATTTCTCGAGAAATACCAGTGTTAAAGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020007.2-4754s1c1
Sequence:CCGGGCACAGAGTTAGCACTCCATACTCGAGTATGGAGTGCTAACTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020007.2-1100s1c1
Sequence:CCGGGAAGTATGTAGAGAGTTTCAACTCGAGTTGAAACTCTCTACATACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020007.2-2131s1c1
Sequence:CCGGAGCCAACCAGATACCCATAATCTCGAGATTATGGGTATCTGGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020007.2-1205s1c1
Sequence:CCGGGCCTGCTTTGATTCACTGAAACTCGAGTTTCAGTGAATCAAAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020007.2-1924s1c1
Sequence:CCGGCGCAGTCTTTAACACTGGTATCTCGAGATACCAGTGTTAAAGACTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020007
VALIDATED
MBNL1 MISSION shRNA Lentiviral Transduction Particles
muscleblind-like splicing regulator 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020007.3-1662s21c1
Sequence:GTACCGGTGACAGCACAATGATTGATACCTCGAGGTATCAATCATTGTGCTGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226192    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020007.3-5043s21c1
Sequence:CCGGCAGATCGATATCTACCAATTTCTCGAGAAATTGGTAGATATCGATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020007.3-2128s21c1
Sequence:CCGGGCCAACCAGATACCCATAATACTCGAGTATTATGGGTATCTGGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020007.3-1994s21c1
Sequence:CCGGTTCTCCCACCAGGCTCAATATCTCGAGATATTGAGCCTGGTGGGAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020007.3-1922s21c1
Sequence:CCGGCAGTCTTTAACACTGGTATTTCTCGAGAAATACCAGTGTTAAAGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020007.2-4754s1c1
Sequence:CCGGGCACAGAGTTAGCACTCCATACTCGAGTATGGAGTGCTAACTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020007.2-1100s1c1
Sequence:CCGGGAAGTATGTAGAGAGTTTCAACTCGAGTTGAAACTCTCTACATACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020007.2-2131s1c1
Sequence:CCGGAGCCAACCAGATACCCATAATCTCGAGATTATGGGTATCTGGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020007.2-1205s1c1
Sequence:CCGGGCCTGCTTTGATTCACTGAAACTCGAGTTTCAGTGAATCAAAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020007.2-1924s1c1
Sequence:CCGGCGCAGTCTTTAACACTGGTATCTCGAGATACCAGTGTTAAAGACTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)