EMAIL THIS PAGE TO A FRIEND

MBNL3

muscleblind-like splicing regulator 3

103 Gene Product Result for
Synonyms: CHCR MBLX MBLX39 MBXL
Gene ID:
Human(55796) Summary: This gene encodes a member of the muscleblind-like family of proteins. The encoded protein may function in regulation of alternative splicing and may play a role in the pathophysiology of myotonic dystrophy. Alternatively spliced transcript variants have been described. [provided by RefSeq, Dec 2009]
Mouse(171170) muscleblind-like 3 (Drosophila)
Rat(302492) muscleblind-like splicing regulator 3
sheep(101110821) muscleblind-like splicing regulator 3
domestic guinea pig(100724619) muscleblind-like splicing regulator 3
naked mole-rat(101709437) muscleblind-like splicing regulator 3
Zebrafish(567027) muscleblind-like 3 (Drosophila)
chicken(422233) muscleblind-like 3 (Drosophila)
domestic cat(101085868) muscleblind-like splicing regulator 3
cow(540550) muscleblind-like 3 (Drosophila)
Horse(100054316) muscleblind-like splicing regulator 3
dog(481055) muscleblind-like splicing regulator 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134163 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134163 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134163 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_133486 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133486 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133486 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018388 Rosetta Predictions human pricing
NM_133486 Rosetta Predictions human pricing
NM_001106949 Rosetta Predictions rat pricing
NM_134163 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210000 predicted 1367
2 SASI_Hs01_00210001 predicted 404
3 SASI_Hs01_00210002 predicted 614
4 SASI_Hs02_00351879 predicted 250
5 SASI_Hs01_00210004 predicted 501
6 SASI_Hs01_00210005 predicted 515
7 SASI_Hs01_00210006 predicted 445
8 SASI_Hs01_00210007 predicted 318
9 SASI_Hs02_00351880 predicted 456
10 SASI_Hs01_00210008 predicted 1349
11 SASI_Hs01_00210003 predicted 1376
12 SASI_Hs01_00210009 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133486 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235827 predicted 1336
2 SASI_Hs01_00235828 predicted 403
3 SASI_Hs01_00235829 predicted 615
4 SASI_Hs02_00363205 predicted 251
5 SASI_Hs01_00235831 predicted 498
6 SASI_Hs01_00235832 predicted 515
7 SASI_Hs01_00235833 predicted 451
8 SASI_Hs01_00235834 predicted 318
9 SASI_Hs02_00363206 predicted 461
10 SASI_Hs01_00235835 predicted 1324
11 SASI_Hs01_00235830 predicted 1344
12 SASI_Hs01_00235836 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106949 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223996 predicted 305
2 SASI_Rn02_00223997 predicted 320
3 SASI_Rn02_00223998 predicted 218
4 SASI_Rn02_00223999 predicted 1079
5 SASI_Rn02_00224000 predicted 438
6 SASI_Rn02_00224001 predicted 391
7 SASI_Rn02_00224002 predicted 1164
8 SASI_Rn02_00224003 predicted 709
9 SASI_Rn02_00224004 predicted 1122
10 SASI_Rn02_00224005 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134163 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107632 predicted 347
2 SASI_Mm01_00107633 predicted 1186
3 SASI_Mm01_00107634 predicted 507
4 SASI_Mm01_00107635 predicted 1163
5 SASI_Mm01_00107636 predicted 1173
6 SASI_Mm01_00107637 predicted 665
7 SASI_Mm02_00339427 predicted 376
8 SASI_Mm01_00107638 predicted 1220
9 SASI_Mm01_00107639 predicted 869
10 SASI_Mm01_00107640 predicted 224
11 SASI_Mm01_00107631 predicted 882
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134163
VALIDATED
MBNL3 MISSION shRNA Bacterial Glycerol Stock
muscleblind-like splicing regulator 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134163.4-1237s21c1
Sequence:CCGGCTTGTACCAACACGACAATAACTCGAGTTATTGTCGTGTTGGTACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134163.4-1006s21c1
Sequence:CCGGGCTCTGGCTAACATGCAGATTCTCGAGAATCTGCATGTTAGCCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134163.4-670s21c1
Sequence:CCGGCGTGAATTTCAGCGTGGAAATCTCGAGATTTCCACGCTGAAATTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134163.4-2619s1c1
Sequence:CCGGGCAGTGAATTAGCAAGCATTTCTCGAGAAATGCTTGCTAATTCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_134163.4-727s1c1
Sequence:CCGGCCTACGGATGTTTCCATGATTCTCGAGAATCATGGAAACATCCGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_134163.4-670s1c1
Sequence:CCGGCGTGAATTTCAGCGTGGAAATCTCGAGATTTCCACGCTGAAATTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_134163.4-1006s1c1
Sequence:CCGGGCTCTGGCTAACATGCAGATTCTCGAGAATCTGCATGTTAGCCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134163.4-366s1c1
Sequence:CCGGGCTAGAAGTTAATGGGAGAAACTCGAGTTTCTCCCATTAACTTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134163.4-366s21c1
Sequence:CCGGGCTAGAAGTTAATGGGAGAAACTCGAGTTTCTCCCATTAACTTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134163
VALIDATED
MBNL3 MISSION shRNA shRNA Plasmid DNA
muscleblind-like splicing regulator 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134163.4-1237s21c1
Sequence:CCGGCTTGTACCAACACGACAATAACTCGAGTTATTGTCGTGTTGGTACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134163.4-1006s21c1
Sequence:CCGGGCTCTGGCTAACATGCAGATTCTCGAGAATCTGCATGTTAGCCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134163.4-670s21c1
Sequence:CCGGCGTGAATTTCAGCGTGGAAATCTCGAGATTTCCACGCTGAAATTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134163.4-2619s1c1
Sequence:CCGGGCAGTGAATTAGCAAGCATTTCTCGAGAAATGCTTGCTAATTCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_134163.4-727s1c1
Sequence:CCGGCCTACGGATGTTTCCATGATTCTCGAGAATCATGGAAACATCCGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_134163.4-670s1c1
Sequence:CCGGCGTGAATTTCAGCGTGGAAATCTCGAGATTTCCACGCTGAAATTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_134163.4-1006s1c1
Sequence:CCGGGCTCTGGCTAACATGCAGATTCTCGAGAATCTGCATGTTAGCCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134163.4-366s1c1
Sequence:CCGGGCTAGAAGTTAATGGGAGAAACTCGAGTTTCTCCCATTAACTTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134163.4-366s21c1
Sequence:CCGGGCTAGAAGTTAATGGGAGAAACTCGAGTTTCTCCCATTAACTTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134163
VALIDATED
MBNL3 MISSION shRNA Lentiviral Transduction Particles
muscleblind-like splicing regulator 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134163.4-1237s21c1
Sequence:CCGGCTTGTACCAACACGACAATAACTCGAGTTATTGTCGTGTTGGTACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134163.4-1006s21c1
Sequence:CCGGGCTCTGGCTAACATGCAGATTCTCGAGAATCTGCATGTTAGCCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134163.4-670s21c1
Sequence:CCGGCGTGAATTTCAGCGTGGAAATCTCGAGATTTCCACGCTGAAATTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134163.4-2619s1c1
Sequence:CCGGGCAGTGAATTAGCAAGCATTTCTCGAGAAATGCTTGCTAATTCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_134163.4-727s1c1
Sequence:CCGGCCTACGGATGTTTCCATGATTCTCGAGAATCATGGAAACATCCGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_134163.4-670s1c1
Sequence:CCGGCGTGAATTTCAGCGTGGAAATCTCGAGATTTCCACGCTGAAATTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_134163.4-1006s1c1
Sequence:CCGGGCTCTGGCTAACATGCAGATTCTCGAGAATCTGCATGTTAGCCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134163.4-366s1c1
Sequence:CCGGGCTAGAAGTTAATGGGAGAAACTCGAGTTTCTCCCATTAACTTCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_134163.4-366s21c1
Sequence:CCGGGCTAGAAGTTAATGGGAGAAACTCGAGTTTCTCCCATTAACTTCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133486
MBNL3 MISSION shRNA Bacterial Glycerol Stock
muscleblind-like splicing regulator 3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000159144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133486.1-138s1c1
Sequence:CCGGGTAGAGAATTTCAGAGAGGAACTCGAGTTCCTCTCTGAAATTCTCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133486.1-1250s1c1
Sequence:CCGGCCAGCCAGCAAATTCAAATAACTCGAGTTATTTGAATTTGCTGGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133486.1-597s1c1
Sequence:CCGGGTTCAGATAAACTGGAGGTTTCTCGAGAAACCTCCAGTTTATCTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133486.1-1220s1c1
Sequence:CCGGGCAGTCAATGTATTAAGCAAACTCGAGTTTGCTTAATACATTGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160141    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133486.1-1333s1c1
Sequence:CCGGCCATCCATCCTATTTGAATTACTCGAGTAATTCAAATAGGATGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133486.1-691s1c1
Sequence:CCGGCATGATTGAAGCGAGTGATAACTCGAGTTATCACTCGCTTCAATCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133486.1-1060s1c1
Sequence:CCGGCAGCATGTTTGTTTCACAGATCTCGAGATCTGTGAAACAAACATGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133486.1-690s1c1
Sequence:CCGGCCATGATTGAAGCGAGTGATACTCGAGTATCACTCGCTTCAATCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133486.1-755s1c1
Sequence:CCGGCGGGAGAAATGCAAGTACTTTCTCGAGAAAGTACTTGCATTTCTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133486.1-200s1c1
Sequence:CCGGCCAAGAGTTTGCCATGTGGAACTCGAGTTCCACATGGCAAACTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133486.1-918s1c1
Sequence:CCGGCCGCTTCAAATATTGTGCCCACTCGAGTGGGCACAATATTTGAAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133486.1-331s1c1
Sequence:CCGGGCGGAACAATCTGATTCAACACTCGAGTGTTGAATCAGATTGTTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161082    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133486.1-1249s1c1
Sequence:CCGGGCCAGCCAGCAAATTCAAATACTCGAGTATTTGAATTTGCTGGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133486
MBNL3 MISSION shRNA shRNA Plasmid DNA
muscleblind-like splicing regulator 3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000159144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133486.1-138s1c1
Sequence:CCGGGTAGAGAATTTCAGAGAGGAACTCGAGTTCCTCTCTGAAATTCTCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133486.1-1250s1c1
Sequence:CCGGCCAGCCAGCAAATTCAAATAACTCGAGTTATTTGAATTTGCTGGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133486.1-597s1c1
Sequence:CCGGGTTCAGATAAACTGGAGGTTTCTCGAGAAACCTCCAGTTTATCTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133486.1-1220s1c1
Sequence:CCGGGCAGTCAATGTATTAAGCAAACTCGAGTTTGCTTAATACATTGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160141    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133486.1-1333s1c1
Sequence:CCGGCCATCCATCCTATTTGAATTACTCGAGTAATTCAAATAGGATGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133486.1-691s1c1
Sequence:CCGGCATGATTGAAGCGAGTGATAACTCGAGTTATCACTCGCTTCAATCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133486.1-1060s1c1
Sequence:CCGGCAGCATGTTTGTTTCACAGATCTCGAGATCTGTGAAACAAACATGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133486.1-690s1c1
Sequence:CCGGCCATGATTGAAGCGAGTGATACTCGAGTATCACTCGCTTCAATCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133486.1-755s1c1
Sequence:CCGGCGGGAGAAATGCAAGTACTTTCTCGAGAAAGTACTTGCATTTCTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133486.1-200s1c1
Sequence:CCGGCCAAGAGTTTGCCATGTGGAACTCGAGTTCCACATGGCAAACTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133486.1-918s1c1
Sequence:CCGGCCGCTTCAAATATTGTGCCCACTCGAGTGGGCACAATATTTGAAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133486.1-331s1c1
Sequence:CCGGGCGGAACAATCTGATTCAACACTCGAGTGTTGAATCAGATTGTTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161082    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133486.1-1249s1c1
Sequence:CCGGGCCAGCCAGCAAATTCAAATACTCGAGTATTTGAATTTGCTGGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133486
MBNL3 MISSION shRNA Lentiviral Transduction Particles
muscleblind-like splicing regulator 3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000159144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133486.1-138s1c1
Sequence:CCGGGTAGAGAATTTCAGAGAGGAACTCGAGTTCCTCTCTGAAATTCTCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133486.1-1250s1c1
Sequence:CCGGCCAGCCAGCAAATTCAAATAACTCGAGTTATTTGAATTTGCTGGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133486.1-597s1c1
Sequence:CCGGGTTCAGATAAACTGGAGGTTTCTCGAGAAACCTCCAGTTTATCTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133486.1-1220s1c1
Sequence:CCGGGCAGTCAATGTATTAAGCAAACTCGAGTTTGCTTAATACATTGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160141    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133486.1-1333s1c1
Sequence:CCGGCCATCCATCCTATTTGAATTACTCGAGTAATTCAAATAGGATGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133486.1-691s1c1
Sequence:CCGGCATGATTGAAGCGAGTGATAACTCGAGTTATCACTCGCTTCAATCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133486.1-1060s1c1
Sequence:CCGGCAGCATGTTTGTTTCACAGATCTCGAGATCTGTGAAACAAACATGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133486.1-690s1c1
Sequence:CCGGCCATGATTGAAGCGAGTGATACTCGAGTATCACTCGCTTCAATCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133486.1-755s1c1
Sequence:CCGGCGGGAGAAATGCAAGTACTTTCTCGAGAAAGTACTTGCATTTCTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133486.1-200s1c1
Sequence:CCGGCCAAGAGTTTGCCATGTGGAACTCGAGTTCCACATGGCAAACTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133486.1-918s1c1
Sequence:CCGGCCGCTTCAAATATTGTGCCCACTCGAGTGGGCACAATATTTGAAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133486.1-331s1c1
Sequence:CCGGGCGGAACAATCTGATTCAACACTCGAGTGTTGAATCAGATTGTTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161082    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133486.1-1249s1c1
Sequence:CCGGGCCAGCCAGCAAATTCAAATACTCGAGTATTTGAATTTGCTGGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)