EMAIL THIS PAGE TO A FRIEND

MBOAT1

membrane bound O-acyltransferase domain containing 1

114 Gene Product Result for
Synonyms: 1 LPEAT1 LPLAT LPLAT 1 LPSAT OACT1 dJ434O11.1
UniProtKB ID: Q6ZNC8, A9EDQ5, B4DL59, B4E3J4, Q86XC2, Q8N9R5
Gene ID:
Human(154141) Summary: This gene belongs to the membrane-bound O-acetyltransferase superfamily. The encoded transmembrane protein is an enzyme that transfers organic compounds, preferably from oleoyl-CoA, to hydroxyl groups of protein targets in membranes. A translocation disrupting this gene may be associated with brachydactyly syndactyly syndrome. Alternately spliced transcript variants have been described for this gene. [provided by RefSeq, Nov 2012]
Mouse(218121) membrane bound O-acyltransferase domain containing 1
Rat(498741) membrane bound O-acyltransferase domain containing 1
Zebrafish(572841) membrane bound O-acyltransferase domain containing 1
dog(488238) membrane bound O-acyltransferase domain containing 1
domestic cat(101090013) membrane bound O-acyltransferase domain containing 1
cow(541284) membrane bound O-acyltransferase domain containing 1
Horse(100066632) membrane bound O-acyltransferase domain containing 1
chicken(420826) membrane bound O-acyltransferase domain containing 1
naked mole-rat(101699551) membrane bound O-acyltransferase domain containing 1
Domestic Rabbit(100353609) membrane bound O-acyltransferase domain containing 1
domestic guinea pig(100732376) membrane bound O-acyltransferase domain containing 1
sheep(101111235) membrane bound O-acyltransferase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153546 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153546 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153546 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_371801 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371801 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371801 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080480 Rosetta Predictions human pricing
XM_371801 Rosetta Predictions human pricing
NM_001109120 Rosetta Predictions rat pricing
XM_574019 Rosetta Predictions rat pricing
NM_153546 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315246 predicted 761
2 SASI_Hs02_00315247 predicted 1345
3 SASI_Hs02_00315248 predicted 1104
4 SASI_Hs02_00315249 predicted 1013
5 SASI_Hs02_00315250 predicted 566
6 SASI_Hs02_00315251 predicted 636
7 SASI_Hs02_00315252 predicted 595
8 SASI_Hs02_00315253 predicted 1450
9 SASI_Hs02_00315254 predicted 1000
10 SASI_Hs02_00315255 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00297035 predicted 1354
2 SASI_Hs01_00297036 predicted 1541
3 SASI_Hs01_00297037 predicted 1784
4 SASI_Hs01_00297038 predicted 1340
5 SASI_Hs01_00297039 predicted 1417
6 SASI_Hs01_00297040 predicted 1663
7 SASI_Hs01_00297041 predicted 1375
8 SASI_Hs01_00297042 predicted 1572
9 SASI_Hs01_00297043 predicted 1786
10 SASI_Hs01_00297044 predicted 1350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109120 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245320 predicted 542
2 SASI_Rn02_00245321 predicted 849
3 SASI_Rn02_00245322 predicted 1232
4 SASI_Rn02_00245323 predicted 334
5 SASI_Rn02_00245324 predicted 972
6 SASI_Rn02_00245325 predicted 552
7 SASI_Rn02_00245326 predicted 1005
8 SASI_Rn02_00245327 predicted 1148
9 SASI_Rn02_00245328 predicted 1516
10 SASI_Rn02_00245329 predicted 1336
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574019 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00190142 predicted 630
2 SASI_Rn01_00190143 predicted 771
3 SASI_Rn01_00190144 predicted 269
4 SASI_Rn01_00190145 predicted 627
5 SASI_Rn01_00190146 predicted 330
6 SASI_Rn01_00190147 predicted 481
7 SASI_Rn01_00190148 predicted 353
8 SASI_Rn01_00190149 predicted 397
9 SASI_Rn01_00190150 predicted 224
10 SASI_Rn01_00190151 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153546 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197323 predicted 1142
2 SASI_Mm01_00197324 predicted 965
3 SASI_Mm01_00197325 predicted 994
4 SASI_Mm01_00197326 predicted 914
5 SASI_Mm01_00197327 predicted 588
6 SASI_Mm01_00197328 predicted 560
7 SASI_Mm01_00197329 predicted 831
8 SASI_Mm01_00197330 predicted 980
9 SASI_Mm01_00197331 predicted 1218
10 SASI_Mm01_00197332 predicted 325
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153546
VALIDATED
MBOAT1 MISSION shRNA Bacterial Glycerol Stock
membrane bound O-acyltransferase domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153546.4-1613s21c1
Sequence:CCGGGGCAGTCTCGGAGTCCAAATTCTCGAGAATTTGGACTCCGAGACTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120992    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153546.1-1859s1c1
Sequence:CCGGGCCTTTCAGAAACACAGCATACTCGAGTATGCTGTGTTTCTGAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153546.1-1330s1c1
Sequence:CCGGCCCTGGATACTACTTCACATTCTCGAGAATGTGAAGTAGTATCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153546.1-801s1c1
Sequence:CCGGCCTTCATCGAAGGGAGACATACTCGAGTATGTCTCCCTTCGATGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153546.1-266s1c1
Sequence:CCGGCCGCTGGATCAGGTTAACTTTCTCGAGAAAGTTAACCTGATCCAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153546.1-1516s1c1
Sequence:CCGGCGAGCCAACCATCAGTTTATACTCGAGTATAAACTGATGGTTGGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153546.4-1768s21c1
Sequence:CCGGTTTCCGCTGCAGGGAATATTTCTCGAGAAATATTCCCTGCAGCGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153546.4-1012s21c1
Sequence:CCGGAGTCGTCTCTGGTACTTATATCTCGAGATATAAGTACCAGAGACGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153546.4-535s21c1
Sequence:CCGGTGCCACATCAGCCGCATTTACCTCGAGGTAAATGCGGCTGATGTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153546.4-1044s21c1
Sequence:CCGGAGCCGCAAAGCCCAAGTATTACTCGAGTAATACTTGGGCTTTGCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153546
VALIDATED
MBOAT1 MISSION shRNA shRNA Plasmid DNA
membrane bound O-acyltransferase domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153546.4-1613s21c1
Sequence:CCGGGGCAGTCTCGGAGTCCAAATTCTCGAGAATTTGGACTCCGAGACTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120992    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153546.1-1859s1c1
Sequence:CCGGGCCTTTCAGAAACACAGCATACTCGAGTATGCTGTGTTTCTGAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153546.1-1330s1c1
Sequence:CCGGCCCTGGATACTACTTCACATTCTCGAGAATGTGAAGTAGTATCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153546.1-801s1c1
Sequence:CCGGCCTTCATCGAAGGGAGACATACTCGAGTATGTCTCCCTTCGATGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153546.1-266s1c1
Sequence:CCGGCCGCTGGATCAGGTTAACTTTCTCGAGAAAGTTAACCTGATCCAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153546.1-1516s1c1
Sequence:CCGGCGAGCCAACCATCAGTTTATACTCGAGTATAAACTGATGGTTGGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153546.4-1768s21c1
Sequence:CCGGTTTCCGCTGCAGGGAATATTTCTCGAGAAATATTCCCTGCAGCGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153546.4-1012s21c1
Sequence:CCGGAGTCGTCTCTGGTACTTATATCTCGAGATATAAGTACCAGAGACGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153546.4-535s21c1
Sequence:CCGGTGCCACATCAGCCGCATTTACCTCGAGGTAAATGCGGCTGATGTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153546.4-1044s21c1
Sequence:CCGGAGCCGCAAAGCCCAAGTATTACTCGAGTAATACTTGGGCTTTGCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153546
VALIDATED
MBOAT1 MISSION shRNA Lentiviral Transduction Particles
membrane bound O-acyltransferase domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153546.4-1613s21c1
Sequence:CCGGGGCAGTCTCGGAGTCCAAATTCTCGAGAATTTGGACTCCGAGACTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120992    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153546.1-1859s1c1
Sequence:CCGGGCCTTTCAGAAACACAGCATACTCGAGTATGCTGTGTTTCTGAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153546.1-1330s1c1
Sequence:CCGGCCCTGGATACTACTTCACATTCTCGAGAATGTGAAGTAGTATCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153546.1-801s1c1
Sequence:CCGGCCTTCATCGAAGGGAGACATACTCGAGTATGTCTCCCTTCGATGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153546.1-266s1c1
Sequence:CCGGCCGCTGGATCAGGTTAACTTTCTCGAGAAAGTTAACCTGATCCAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153546.1-1516s1c1
Sequence:CCGGCGAGCCAACCATCAGTTTATACTCGAGTATAAACTGATGGTTGGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153546.4-1768s21c1
Sequence:CCGGTTTCCGCTGCAGGGAATATTTCTCGAGAAATATTCCCTGCAGCGGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153546.4-1012s21c1
Sequence:CCGGAGTCGTCTCTGGTACTTATATCTCGAGATATAAGTACCAGAGACGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153546.4-535s21c1
Sequence:CCGGTGCCACATCAGCCGCATTTACCTCGAGGTAAATGCGGCTGATGTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153546.4-1044s21c1
Sequence:CCGGAGCCGCAAAGCCCAAGTATTACTCGAGTAATACTTGGGCTTTGCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371801
MBOAT1 MISSION shRNA Bacterial Glycerol Stock
membrane bound O-acyltransferase domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371801.2-826s1c1
Sequence:CCGGCGAATATACATCTTCCACTATCTCGAGATAGTGGAAGATGTATATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371801.2-1900s1c1
Sequence:CCGGCCTCAGACTCTGAACTCTATTCTCGAGAATAGAGTTCAGAGTCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371801.2-695s1c1
Sequence:CCGGGCTGGTACTCTGTGCATCTTTCTCGAGAAAGATGCACAGAGTACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371801.2-1398s1c1
Sequence:CCGGCGGAGTGGATAAGAATGGGAACTCGAGTTCCCATTCTTATCCACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371801.2-970s1c1
Sequence:CCGGCGACTTGCTATCAAAGTGAAACTCGAGTTTCACTTTGATAGCAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371801
MBOAT1 MISSION shRNA shRNA Plasmid DNA
membrane bound O-acyltransferase domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371801.2-826s1c1
Sequence:CCGGCGAATATACATCTTCCACTATCTCGAGATAGTGGAAGATGTATATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371801.2-1900s1c1
Sequence:CCGGCCTCAGACTCTGAACTCTATTCTCGAGAATAGAGTTCAGAGTCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371801.2-695s1c1
Sequence:CCGGGCTGGTACTCTGTGCATCTTTCTCGAGAAAGATGCACAGAGTACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371801.2-1398s1c1
Sequence:CCGGCGGAGTGGATAAGAATGGGAACTCGAGTTCCCATTCTTATCCACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371801.2-970s1c1
Sequence:CCGGCGACTTGCTATCAAAGTGAAACTCGAGTTTCACTTTGATAGCAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371801
MBOAT1 MISSION shRNA Lentiviral Transduction Particles
membrane bound O-acyltransferase domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371801.2-826s1c1
Sequence:CCGGCGAATATACATCTTCCACTATCTCGAGATAGTGGAAGATGTATATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371801.2-1900s1c1
Sequence:CCGGCCTCAGACTCTGAACTCTATTCTCGAGAATAGAGTTCAGAGTCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371801.2-695s1c1
Sequence:CCGGGCTGGTACTCTGTGCATCTTTCTCGAGAAAGATGCACAGAGTACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371801.2-1398s1c1
Sequence:CCGGCGGAGTGGATAAGAATGGGAACTCGAGTTCCCATTCTTATCCACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371801.2-970s1c1
Sequence:CCGGCGACTTGCTATCAAAGTGAAACTCGAGTTTCACTTTGATAGCAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)