EMAIL THIS PAGE TO A FRIEND

MBOAT2

membrane bound O-acyltransferase domain containing 2

116 Gene Product Result for
Synonyms: LPCAT4 OACT2
UniProtKB ID: Q6ZWT7, A9EDR2, Q8NCE7, Q96KY4
Gene ID:
Mouse(67216) membrane bound O-acyltransferase domain containing 2
Rat(313997) membrane bound O-acyltransferase domain containing 2
sheep(101116033) membrane bound O-acyltransferase domain containing 2
Domestic Rabbit(100353823) membrane bound O-acyltransferase domain containing 2
naked mole-rat(101705898) membrane bound O-acyltransferase domain containing 2
chicken(421925) membrane bound O-acyltransferase domain containing 2
cow(785489) membrane bound O-acyltransferase domain containing 2
Horse(100072531) membrane bound O-acyltransferase domain containing 2
domestic cat(101090007) membrane bound O-acyltransferase domain containing 2
dog(475658) membrane bound O-acyltransferase domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138799 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138799 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138799 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026037 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026037 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026037 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138799 Rosetta Predictions human pricing
NM_001108016 Rosetta Predictions rat pricing
NM_001083341 Rosetta Predictions mouse pricing
NM_026037 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138799 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047720 predicted 1259
2 SASI_Hs01_00047721 predicted 552
3 SASI_Hs01_00047722 predicted 480
4 SASI_Hs01_00047723 predicted 838
5 SASI_Hs02_00363952 predicted 780
6 SASI_Hs01_00047724 predicted 811
7 SASI_Hs01_00047725 predicted 469
8 SASI_Hs01_00047726 predicted 1123
9 SASI_Hs01_00047727 predicted 835
10 SASI_Hs01_00047728 predicted 941
11 SASI_Hs01_00047729 predicted 1137
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108016 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234535 predicted 1374
2 SASI_Rn02_00234536 predicted 1451
3 SASI_Rn02_00234537 predicted 914
4 SASI_Rn02_00234538 predicted 326
5 SASI_Rn02_00234539 predicted 932
6 SASI_Rn02_00234540 predicted 1749
7 SASI_Rn02_00234541 predicted 412
8 SASI_Rn02_00234542 predicted 1072
9 SASI_Rn02_00234543 predicted 1385
10 SASI_Rn02_00234544 predicted 579
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083341 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299691 predicted 1191
2 SASI_Mm02_00299692 predicted 1275
3 SASI_Mm02_00299693 predicted 1648
4 SASI_Mm02_00299694 predicted 804
5 SASI_Mm02_00299695 predicted 1630
6 SASI_Mm02_00299696 predicted 1614
7 SASI_Mm02_00299697 predicted 962
8 SASI_Mm02_00299698 predicted 1500
9 SASI_Mm02_00299699 predicted 964
10 SASI_Mm02_00299700 predicted 1336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026037 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184555 predicted 1284
2 SASI_Mm01_00184557 predicted 1368
3 SASI_Mm01_00184558 predicted 1741
4 SASI_Mm01_00184559 predicted 909
5 SASI_Mm02_00329529 predicted 1723
6 SASI_Mm01_00184560 predicted 1712
7 SASI_Mm01_00184561 predicted 1054
8 SASI_Mm01_00184563 predicted 1588
9 SASI_Mm02_00329530 predicted 1059
10 SASI_Mm02_00329531 predicted 1440
11 SASI_Mm01_00184556 predicted 232
12 SASI_Mm01_00184562 predicted 641
13 SASI_Mm01_00184564 predicted 292
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138799
VALIDATED
MBOAT2 MISSION shRNA Bacterial Glycerol Stock
membrane bound O-acyltransferase domain containing 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138799.2-525s21c1
Sequence:CCGGCAGGCCCAATGATGATCATTACTCGAGTAATGATCATCATTGGGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138799.2-1464s21c1
Sequence:CCGGTTTACAGCTCCTGGTATTATTCTCGAGAATAATACCAGGAGCTGTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138799.2-711s21c1
Sequence:CCGGGCTCTTACAAAGACTACATTACTCGAGTAATGTAGTCTTTGTAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138799.2-2073s21c1
Sequence:CCGGCTTGCCTTAAACCCTCTATTTCTCGAGAAATAGAGGGTTTAAGGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138799.2-875s21c1
Sequence:CCGGTTGACCATCTGTACAACATTACTCGAGTAATGTTGTACAGATGGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138799.2-248s21c1
Sequence:CCGGGCCATTTGGTTTCGAACTTATCTCGAGATAAGTTCGAAACCAAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138799.2-482s1c1
Sequence:CCGGCGAGTCTATATCTTTGACTATCTCGAGATAGTCAAAGATATAGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138799.2-711s1c1
Sequence:CCGGGCTCTTACAAAGACTACATTACTCGAGTAATGTAGTCTTTGTAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138799.2-1262s1c1
Sequence:CCGGCCAGGATATTATCTAACGTTTCTCGAGAAACGTTAGATAATATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138799
VALIDATED
MBOAT2 MISSION shRNA shRNA Plasmid DNA
membrane bound O-acyltransferase domain containing 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138799.2-525s21c1
Sequence:CCGGCAGGCCCAATGATGATCATTACTCGAGTAATGATCATCATTGGGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138799.2-1464s21c1
Sequence:CCGGTTTACAGCTCCTGGTATTATTCTCGAGAATAATACCAGGAGCTGTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138799.2-711s21c1
Sequence:CCGGGCTCTTACAAAGACTACATTACTCGAGTAATGTAGTCTTTGTAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138799.2-2073s21c1
Sequence:CCGGCTTGCCTTAAACCCTCTATTTCTCGAGAAATAGAGGGTTTAAGGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138799.2-875s21c1
Sequence:CCGGTTGACCATCTGTACAACATTACTCGAGTAATGTTGTACAGATGGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138799.2-248s21c1
Sequence:CCGGGCCATTTGGTTTCGAACTTATCTCGAGATAAGTTCGAAACCAAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138799.2-482s1c1
Sequence:CCGGCGAGTCTATATCTTTGACTATCTCGAGATAGTCAAAGATATAGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138799.2-711s1c1
Sequence:CCGGGCTCTTACAAAGACTACATTACTCGAGTAATGTAGTCTTTGTAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138799.2-1262s1c1
Sequence:CCGGCCAGGATATTATCTAACGTTTCTCGAGAAACGTTAGATAATATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138799
VALIDATED
MBOAT2 MISSION shRNA Lentiviral Transduction Particles
membrane bound O-acyltransferase domain containing 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138799.2-525s21c1
Sequence:CCGGCAGGCCCAATGATGATCATTACTCGAGTAATGATCATCATTGGGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138799.2-1464s21c1
Sequence:CCGGTTTACAGCTCCTGGTATTATTCTCGAGAATAATACCAGGAGCTGTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138799.2-711s21c1
Sequence:CCGGGCTCTTACAAAGACTACATTACTCGAGTAATGTAGTCTTTGTAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138799.2-2073s21c1
Sequence:CCGGCTTGCCTTAAACCCTCTATTTCTCGAGAAATAGAGGGTTTAAGGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138799.2-875s21c1
Sequence:CCGGTTGACCATCTGTACAACATTACTCGAGTAATGTTGTACAGATGGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138799.2-248s21c1
Sequence:CCGGGCCATTTGGTTTCGAACTTATCTCGAGATAAGTTCGAAACCAAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138799.2-482s1c1
Sequence:CCGGCGAGTCTATATCTTTGACTATCTCGAGATAGTCAAAGATATAGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138799.2-711s1c1
Sequence:CCGGGCTCTTACAAAGACTACATTACTCGAGTAATGTAGTCTTTGTAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138799.2-1262s1c1
Sequence:CCGGCCAGGATATTATCTAACGTTTCTCGAGAAACGTTAGATAATATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026037
VALIDATED
MBOAT2 MISSION shRNA Bacterial Glycerol Stock
membrane bound O-acyltransferase domain containing 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026037.3-493s1c1
Sequence:CCGGCAGGCCCAATGATGATCATTACTCGAGTAATGATCATCATTGGGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026037.3-493s21c1
Sequence:CCGGCAGGCCCAATGATGATCATTACTCGAGTAATGATCATCATTGGGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026037.3-974s21c1
Sequence:CCGGGACCTTAGCTGACGCCATTAACTCGAGTTAATGGCGTCAGCTAAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026037.3-2084s21c1
Sequence:CCGGGACGATTTCAGTATTCGATATCTCGAGATATCGAATACTGAAATCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026037.3-216s21c1
Sequence:CCGGGCCGTTTGGTTTCGAACTTATCTCGAGATAAGTTCGAAACCAAACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026037.3-441s21c1
Sequence:CCGGCAGATTACTAGAGTCTATATCCTCGAGGATATAGACTCTAGTAATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175588    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026037.2-2071s1c1
Sequence:CCGGCCAAATGAATGTCTTGCCTTACTCGAGTAAGGCAAGACATTCATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026037.2-391s1c1
Sequence:CCGGCCTTACACTTTCTTGTACAAACTCGAGTTTGTACAAGAAAGTGTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026037.2-469s1c1
Sequence:CCGGGCTTTGTGTTTGCTTTGGGATCTCGAGATCCCAAAGCAAACACAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026037
VALIDATED
MBOAT2 MISSION shRNA shRNA Plasmid DNA
membrane bound O-acyltransferase domain containing 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026037.3-493s1c1
Sequence:CCGGCAGGCCCAATGATGATCATTACTCGAGTAATGATCATCATTGGGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026037.3-493s21c1
Sequence:CCGGCAGGCCCAATGATGATCATTACTCGAGTAATGATCATCATTGGGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026037.3-974s21c1
Sequence:CCGGGACCTTAGCTGACGCCATTAACTCGAGTTAATGGCGTCAGCTAAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026037.3-2084s21c1
Sequence:CCGGGACGATTTCAGTATTCGATATCTCGAGATATCGAATACTGAAATCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026037.3-216s21c1
Sequence:CCGGGCCGTTTGGTTTCGAACTTATCTCGAGATAAGTTCGAAACCAAACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026037.3-441s21c1
Sequence:CCGGCAGATTACTAGAGTCTATATCCTCGAGGATATAGACTCTAGTAATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175588    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026037.2-2071s1c1
Sequence:CCGGCCAAATGAATGTCTTGCCTTACTCGAGTAAGGCAAGACATTCATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026037.2-391s1c1
Sequence:CCGGCCTTACACTTTCTTGTACAAACTCGAGTTTGTACAAGAAAGTGTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026037.2-469s1c1
Sequence:CCGGGCTTTGTGTTTGCTTTGGGATCTCGAGATCCCAAAGCAAACACAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026037
VALIDATED
MBOAT2 MISSION shRNA Lentiviral Transduction Particles
membrane bound O-acyltransferase domain containing 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026037.3-493s1c1
Sequence:CCGGCAGGCCCAATGATGATCATTACTCGAGTAATGATCATCATTGGGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026037.3-493s21c1
Sequence:CCGGCAGGCCCAATGATGATCATTACTCGAGTAATGATCATCATTGGGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026037.3-974s21c1
Sequence:CCGGGACCTTAGCTGACGCCATTAACTCGAGTTAATGGCGTCAGCTAAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026037.3-2084s21c1
Sequence:CCGGGACGATTTCAGTATTCGATATCTCGAGATATCGAATACTGAAATCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026037.3-216s21c1
Sequence:CCGGGCCGTTTGGTTTCGAACTTATCTCGAGATAAGTTCGAAACCAAACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026037.3-441s21c1
Sequence:CCGGCAGATTACTAGAGTCTATATCCTCGAGGATATAGACTCTAGTAATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175588    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026037.2-2071s1c1
Sequence:CCGGCCAAATGAATGTCTTGCCTTACTCGAGTAAGGCAAGACATTCATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026037.2-391s1c1
Sequence:CCGGCCTTACACTTTCTTGTACAAACTCGAGTTTGTACAAGAAAGTGTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026037.2-469s1c1
Sequence:CCGGGCTTTGTGTTTGCTTTGGGATCTCGAGATCCCAAAGCAAACACAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)