EMAIL THIS PAGE TO A FRIEND

MBOAT4

membrane bound O-acyltransferase domain containing 4

54 Gene Product Result for
Synonyms: GOAT OACT4
UniProtKB ID: Q96T53, B1Q003
Gene ID:
Mouse(234155) membrane bound O-acyltransferase domain containing 4
Rat(306515) membrane bound O-acyltransferase domain containing 4
Zebrafish(795709) membrane bound O-acyltransferase domain containing 4
domestic cat(101093681) membrane bound O-acyltransferase domain containing 4
cow(510471) membrane bound O-acyltransferase domain containing 4
Horse(100062682) membrane bound O-acyltransferase domain containing 4
dog(100529112) membrane bound O-acyltransferase domain containing 4
chicken(428757) membrane bound O-acyltransferase domain containing 4
naked mole-rat(101706241) membrane bound O-acyltransferase domain containing 4
Domestic Rabbit(100338553) membrane bound O-acyltransferase domain containing 4
domestic guinea pig(100730241) membrane bound O-acyltransferase domain containing 4
sheep(101104296) membrane bound O-acyltransferase domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001100916 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001100916 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001100916 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001126314 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001126314 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001126314 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001731 MISSION® esiRNA esiRNA targeting human MBOAT4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100916 Rosetta Predictions human pricing
NM_001107317 Rosetta Predictions rat pricing
NM_001126314 Rosetta Predictions mouse pricing
XM_134120 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322535 predicted 706
2 SASI_Hs02_00322536 predicted 625
3 SASI_Hs02_00322537 predicted 968
4 SASI_Hs02_00322538 predicted 1165
5 SASI_Hs02_00322539 predicted 1241
6 SASI_Hs02_00322540 predicted 776
7 SASI_Hs02_00322541 predicted 957
8 SASI_Hs02_00322542 predicted 438
9 SASI_Hs02_00322543 predicted 789
10 SASI_Hs02_00322544 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107317 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227645 predicted 717
2 SASI_Rn02_00227646 predicted 691
3 SASI_Rn02_00227647 predicted 368
4 SASI_Rn02_00227648 predicted 403
5 SASI_Rn02_00227649 predicted 220
6 SASI_Rn02_00227650 predicted 430
7 SASI_Rn02_00227651 predicted 511
8 SASI_Rn02_00227652 predicted 549
9 SASI_Rn02_00227653 predicted 232
10 SASI_Rn02_00227654 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126314 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309925 predicted 1425
2 SASI_Mm02_00309926 predicted 644
3 SASI_Mm02_00309927 predicted 1134
4 SASI_Mm02_00309928 predicted 631
5 SASI_Mm02_00309929 predicted 1379
6 SASI_Mm02_00309930 predicted 1433
7 SASI_Mm02_00309931 predicted 1133
8 SASI_Mm02_00309932 predicted 553
9 SASI_Mm02_00309933 predicted 608
10 SASI_Mm02_00309934 predicted 1350
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_134120 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00241787 predicted 1040
2 SASI_Mm01_00241788 predicted 1303
3 SASI_Mm01_00241789 predicted 1330
4 SASI_Mm01_00241790 predicted 1345
5 SASI_Mm01_00241791 predicted 1203
6 SASI_Mm01_00241792 predicted 1344
7 SASI_Mm01_00241793 predicted 1305
8 SASI_Mm01_00241794 predicted 1335
9 SASI_Mm01_00241795 predicted 1191
10 SASI_Mm01_00241796 predicted 1035
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001100916
MBOAT4 MISSION shRNA Bacterial Glycerol Stock
membrane bound O-acyltransferase domain containing 4
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000281434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100916.1-1443s21c1
Sequence:CCGGCCAGATGACGCATCGATAATGCTCGAGCATTATCGATGCGTCATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100916.1-1019s21c1
Sequence:CCGGATGGCTCCGACGGCTTGTATTCTCGAGAATACAAGCCGTCGGAGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100916.1-561s21c1
Sequence:CCGGTGTAAGGCACTGCCCTATTTCCTCGAGGAAATAGGGCAGTGCCTTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100916.1-720s21c1
Sequence:CCGGCTTGGACTAGAATGCCTAAACCTCGAGGTTTAGGCATTCTAGTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001100916
MBOAT4 MISSION shRNA shRNA Plasmid DNA
membrane bound O-acyltransferase domain containing 4
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000281434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100916.1-1443s21c1
Sequence:CCGGCCAGATGACGCATCGATAATGCTCGAGCATTATCGATGCGTCATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100916.1-1019s21c1
Sequence:CCGGATGGCTCCGACGGCTTGTATTCTCGAGAATACAAGCCGTCGGAGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100916.1-561s21c1
Sequence:CCGGTGTAAGGCACTGCCCTATTTCCTCGAGGAAATAGGGCAGTGCCTTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100916.1-720s21c1
Sequence:CCGGCTTGGACTAGAATGCCTAAACCTCGAGGTTTAGGCATTCTAGTCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001100916
MBOAT4 MISSION shRNA Lentiviral Transduction Particles
membrane bound O-acyltransferase domain containing 4
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000281434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100916.1-1443s21c1
Sequence:CCGGCCAGATGACGCATCGATAATGCTCGAGCATTATCGATGCGTCATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100916.1-1019s21c1
Sequence:CCGGATGGCTCCGACGGCTTGTATTCTCGAGAATACAAGCCGTCGGAGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100916.1-561s21c1
Sequence:CCGGTGTAAGGCACTGCCCTATTTCCTCGAGGAAATAGGGCAGTGCCTTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100916.1-720s21c1
Sequence:CCGGCTTGGACTAGAATGCCTAAACCTCGAGGTTTAGGCATTCTAGTCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001126314
MBOAT4 MISSION shRNA Bacterial Glycerol Stock
membrane bound O-acyltransferase domain containing 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001126314.2-1669s21c1
Sequence:CCGGAGTCCTAGTTTAGCGTCTTTCCTCGAGGAAAGACGCTAAACTAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126314.2-644s21c1
Sequence:CCGGAGCTCTTTGTATCCGAGTATCCTCGAGGATACTCGGATACAAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126314.2-811s21c1
Sequence:CCGGGCTCTTTAAACTCACCTATTACTCGAGTAATAGGTGAGTTTAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126314.2-361s21c1
Sequence:CCGGGGGTCTTCACTACACCGAATACTCGAGTATTCGGTGTAGTGAAGACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126314.2-1215s21c1
Sequence:CCGGCTCATACCCAACTCATCATTGCTCGAGCAATGATGAGTTGGGTATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001126314
MBOAT4 MISSION shRNA shRNA Plasmid DNA
membrane bound O-acyltransferase domain containing 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001126314.2-1669s21c1
Sequence:CCGGAGTCCTAGTTTAGCGTCTTTCCTCGAGGAAAGACGCTAAACTAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126314.2-644s21c1
Sequence:CCGGAGCTCTTTGTATCCGAGTATCCTCGAGGATACTCGGATACAAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126314.2-811s21c1
Sequence:CCGGGCTCTTTAAACTCACCTATTACTCGAGTAATAGGTGAGTTTAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126314.2-361s21c1
Sequence:CCGGGGGTCTTCACTACACCGAATACTCGAGTATTCGGTGTAGTGAAGACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126314.2-1215s21c1
Sequence:CCGGCTCATACCCAACTCATCATTGCTCGAGCAATGATGAGTTGGGTATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001126314
MBOAT4 MISSION shRNA Lentiviral Transduction Particles
membrane bound O-acyltransferase domain containing 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001126314.2-1669s21c1
Sequence:CCGGAGTCCTAGTTTAGCGTCTTTCCTCGAGGAAAGACGCTAAACTAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126314.2-644s21c1
Sequence:CCGGAGCTCTTTGTATCCGAGTATCCTCGAGGATACTCGGATACAAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126314.2-811s21c1
Sequence:CCGGGCTCTTTAAACTCACCTATTACTCGAGTAATAGGTGAGTTTAAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126314.2-361s21c1
Sequence:CCGGGGGTCTTCACTACACCGAATACTCGAGTATTCGGTGTAGTGAAGACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126314.2-1215s21c1
Sequence:CCGGCTCATACCCAACTCATCATTGCTCGAGCAATGATGAGTTGGGTATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)