EMAIL THIS PAGE TO A FRIEND

MBOAT7

membrane bound O-acyltransferase domain containing 7

62 Gene Product Result for
Synonyms: BB1 LENG4 LPIAT LRC4 MBOA7 OACT7 hMBOA-7
Gene ID:
Human(79143) Summary: This gene encodes a member of the membrane-bound O-acyltransferases family of integral membrane proteins that have acyltransferase activity. The encoded protein is a lysophosphatidylinositol acyltransferase that has specificity for arachidonoyl-CoA as an acyl donor. This protein is involved in the reacylation of phospholipids as part of the phospholipid remodeling pathway known as the Land cycle. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
Mouse(77582) membrane bound O-acyltransferase domain containing 7
Rat(308309) membrane bound O-acyltransferase domain containing 7
sheep(101107304) membrane bound O-acyltransferase domain containing 7
domestic guinea pig(100735624) membrane bound O-acyltransferase domain containing 7
Domestic Rabbit(100328778) membrane bound O-acyltransferase domain containing 7
naked mole-rat(101723338) membrane bound O-acyltransferase domain containing 7
Zebrafish(393509) membrane bound O-acyltransferase domain containing 7
cow(504236) membrane bound O-acyltransferase domain containing 7
domestic cat(101101522) membrane bound O-acyltransferase domain containing 7
dog(100683790) membrane bound O-acyltransferase domain containing 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024298 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024298 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024298 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029934 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029934 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029934 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU068441 MISSION® esiRNA esiRNA human LENG4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024298 Rosetta Predictions human pricing
NM_001134978 Rosetta Predictions rat pricing
XM_218185 Rosetta Predictions rat pricing
NM_029934 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024298 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070762 predicted 1423
2 SASI_Hs01_00070763 predicted 1374
3 SASI_Hs01_00070764 predicted 930
4 SASI_Hs01_00070765 predicted 859
5 SASI_Hs01_00070766 predicted 1560
6 SASI_Hs01_00070767 predicted 1960
7 SASI_Hs01_00070768 predicted 1759
8 SASI_Hs01_00070769 predicted 1743
9 SASI_Hs01_00070770 predicted 2281
10 SASI_Hs02_00356642 predicted 2102
11 SASI_Hs01_00070771 predicted 2289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134978 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259184 predicted 1434
2 SASI_Rn02_00259185 predicted 599
3 SASI_Rn02_00259186 predicted 1504
4 SASI_Rn02_00259187 predicted 1499
5 SASI_Rn02_00259188 predicted 568
6 SASI_Rn02_00259189 predicted 1303
7 SASI_Rn02_00259190 predicted 366
8 SASI_Rn02_00259191 predicted 225
9 SASI_Rn02_00259192 predicted 947
10 SASI_Rn02_00259193 predicted 1096
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218185 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00188023 predicted 1055
2 SASI_Rn01_00188024 predicted 912
3 SASI_Rn01_00188025 predicted 1085
4 SASI_Rn01_00188026 predicted 1197
5 SASI_Rn01_00188027 predicted 946
6 SASI_Rn01_00188028 predicted 394
7 SASI_Rn01_00188029 predicted 357
8 SASI_Rn01_00188030 predicted 457
9 SASI_Rn01_00188031 predicted 1020
10 SASI_Rn01_00188032 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029934 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194669 predicted 1690
2 SASI_Mm02_00336216 predicted 1517
3 SASI_Mm01_00194670 predicted 2006
4 SASI_Mm01_00194671 predicted 839
5 SASI_Mm01_00194672 predicted 2631
6 SASI_Mm02_00336217 predicted 2032
7 SASI_Mm01_00194675 predicted 1290
8 SASI_Mm01_00194676 predicted 1109
9 SASI_Mm01_00194677 predicted 795
10 SASI_Mm02_00336218 predicted 1243
11 SASI_Mm01_00194673 predicted 1008
12 SASI_Mm01_00194674 predicted 1407
13 SASI_Mm01_00194678 predicted 933
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024298
VALIDATED
MBOAT7 MISSION shRNA Bacterial Glycerol Stock
membrane bound O-acyltransferase domain containing 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_024298.3-1454s21c1
Sequence:CCGGCGACTGCTACAGCACAGATTTCTCGAGAAATCTGTGCTGTAGCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_024298.3-1529s21c1
Sequence:CCGGGCTGGCGCAGTATATCTACAACTCGAGTTGTAGATATACTGCGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_024298.3-692s21c1
Sequence:CCGGCCACACTTTGCATTCTCTGGTCTCGAGACCAGAGAATGCAAAGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_024298.3-575s21c1
Sequence:CCGGAGTGGTTCTTCTTATCTCCATCTCGAGATGGAGATAAGAAGAACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024298.2-1387s1c1
Sequence:CCGGCGACTGCTACAGCACAGATTTCTCGAGAAATCTGTGCTGTAGCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024298.2-508s1c1
Sequence:CCGGAGTGGTTCTTCTTATCTCCATCTCGAGATGGAGATAAGAAGAACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_024298.2-625s1c1
Sequence:CCGGCCACACTTTGCATTCTCTGGTCTCGAGACCAGAGAATGCAAAGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_024298.2-1462s1c1
Sequence:CCGGGCTGGCGCAGTATATCTACAACTCGAGTTGTAGATATACTGCGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024298
VALIDATED
MBOAT7 MISSION shRNA shRNA Plasmid DNA
membrane bound O-acyltransferase domain containing 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_024298.3-1454s21c1
Sequence:CCGGCGACTGCTACAGCACAGATTTCTCGAGAAATCTGTGCTGTAGCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_024298.3-1529s21c1
Sequence:CCGGGCTGGCGCAGTATATCTACAACTCGAGTTGTAGATATACTGCGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_024298.3-692s21c1
Sequence:CCGGCCACACTTTGCATTCTCTGGTCTCGAGACCAGAGAATGCAAAGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_024298.3-575s21c1
Sequence:CCGGAGTGGTTCTTCTTATCTCCATCTCGAGATGGAGATAAGAAGAACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024298.2-1387s1c1
Sequence:CCGGCGACTGCTACAGCACAGATTTCTCGAGAAATCTGTGCTGTAGCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024298.2-508s1c1
Sequence:CCGGAGTGGTTCTTCTTATCTCCATCTCGAGATGGAGATAAGAAGAACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_024298.2-625s1c1
Sequence:CCGGCCACACTTTGCATTCTCTGGTCTCGAGACCAGAGAATGCAAAGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_024298.2-1462s1c1
Sequence:CCGGGCTGGCGCAGTATATCTACAACTCGAGTTGTAGATATACTGCGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024298
VALIDATED
MBOAT7 MISSION shRNA Lentiviral Transduction Particles
membrane bound O-acyltransferase domain containing 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_024298.3-1454s21c1
Sequence:CCGGCGACTGCTACAGCACAGATTTCTCGAGAAATCTGTGCTGTAGCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_024298.3-1529s21c1
Sequence:CCGGGCTGGCGCAGTATATCTACAACTCGAGTTGTAGATATACTGCGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_024298.3-692s21c1
Sequence:CCGGCCACACTTTGCATTCTCTGGTCTCGAGACCAGAGAATGCAAAGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_024298.3-575s21c1
Sequence:CCGGAGTGGTTCTTCTTATCTCCATCTCGAGATGGAGATAAGAAGAACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_024298.2-1387s1c1
Sequence:CCGGCGACTGCTACAGCACAGATTTCTCGAGAAATCTGTGCTGTAGCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_024298.2-508s1c1
Sequence:CCGGAGTGGTTCTTCTTATCTCCATCTCGAGATGGAGATAAGAAGAACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_024298.2-625s1c1
Sequence:CCGGCCACACTTTGCATTCTCTGGTCTCGAGACCAGAGAATGCAAAGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_024298.2-1462s1c1
Sequence:CCGGGCTGGCGCAGTATATCTACAACTCGAGTTGTAGATATACTGCGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029934
MBOAT7 MISSION shRNA Bacterial Glycerol Stock
membrane bound O-acyltransferase domain containing 7
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217121    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029934.3-2451s1c1
Sequence:CCGGCTGCTAACATCAGGGTATTACCTCGAGGTAATACCCTGATGTTAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029934.3-1867s1c1
Sequence:CCGGCTGGTTACTACCTAAGCTTCACTCGAGTGAAGCTTAGGTAGTAACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029934.3-2074s21c1
Sequence:CCGGTCTACTTCTGGGTCCACTTTCCTCGAGGAAAGTGGACCCAGAAGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029934.3-1998s21c1
Sequence:CCGGATGCGTGCCTACGACTACATGCTCGAGCATGTAGTCGTAGGCACGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029934.3-837s21c1
Sequence:CCGGCCTGTTGGCTTCCTCTTTAAGCTCGAGCTTAAAGAGGAAGCCAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029934.3-1234s21c1
Sequence:CCGGTGATGGAGACACTCAGCTATACTCGAGTATAGCTGAGTGTCTCCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029934.3-1684s21c1
Sequence:CCGGTCCGTAACATCGACTGCTATGCTCGAGCATAGCAGTCGATGTTACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029934.2-1254s1c1
Sequence:CCGGCTACTGTTACGTGGGAATCATCTCGAGATGATTCCCACGTAACAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029934
MBOAT7 MISSION shRNA shRNA Plasmid DNA
membrane bound O-acyltransferase domain containing 7
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217121    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029934.3-2451s1c1
Sequence:CCGGCTGCTAACATCAGGGTATTACCTCGAGGTAATACCCTGATGTTAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029934.3-1867s1c1
Sequence:CCGGCTGGTTACTACCTAAGCTTCACTCGAGTGAAGCTTAGGTAGTAACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029934.3-2074s21c1
Sequence:CCGGTCTACTTCTGGGTCCACTTTCCTCGAGGAAAGTGGACCCAGAAGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029934.3-1998s21c1
Sequence:CCGGATGCGTGCCTACGACTACATGCTCGAGCATGTAGTCGTAGGCACGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029934.3-837s21c1
Sequence:CCGGCCTGTTGGCTTCCTCTTTAAGCTCGAGCTTAAAGAGGAAGCCAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029934.3-1234s21c1
Sequence:CCGGTGATGGAGACACTCAGCTATACTCGAGTATAGCTGAGTGTCTCCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029934.3-1684s21c1
Sequence:CCGGTCCGTAACATCGACTGCTATGCTCGAGCATAGCAGTCGATGTTACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029934.2-1254s1c1
Sequence:CCGGCTACTGTTACGTGGGAATCATCTCGAGATGATTCCCACGTAACAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029934
MBOAT7 MISSION shRNA Lentiviral Transduction Particles
membrane bound O-acyltransferase domain containing 7
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217121    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029934.3-2451s1c1
Sequence:CCGGCTGCTAACATCAGGGTATTACCTCGAGGTAATACCCTGATGTTAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029934.3-1867s1c1
Sequence:CCGGCTGGTTACTACCTAAGCTTCACTCGAGTGAAGCTTAGGTAGTAACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029934.3-2074s21c1
Sequence:CCGGTCTACTTCTGGGTCCACTTTCCTCGAGGAAAGTGGACCCAGAAGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029934.3-1998s21c1
Sequence:CCGGATGCGTGCCTACGACTACATGCTCGAGCATGTAGTCGTAGGCACGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029934.3-837s21c1
Sequence:CCGGCCTGTTGGCTTCCTCTTTAAGCTCGAGCTTAAAGAGGAAGCCAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029934.3-1234s21c1
Sequence:CCGGTGATGGAGACACTCAGCTATACTCGAGTATAGCTGAGTGTCTCCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029934.3-1684s21c1
Sequence:CCGGTCCGTAACATCGACTGCTATGCTCGAGCATAGCAGTCGATGTTACGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029934.2-1254s1c1
Sequence:CCGGCTACTGTTACGTGGGAATCATCTCGAGATGATTCCCACGTAACAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)