EMAIL THIS PAGE TO A FRIEND

MBP

myelin basic protein

306 Gene Product Result for
Gene ID:
Human(4155) Summary: The protein encoded by the classic MBP gene is a major constituent of the myelin sheath of oligodendrocytes and Schwann cells in the nervous system. However, MBP-related transcripts are also present in the bone marrow and the immune system. These mRNAs arise from the long MBP gene (otherwise called 'Golli-MBP') that contains 3 additional exons located upstream of the classic MBP exons. Alternative splicing from the Golli and the MBP transcription start sites gives rise to 2 sets of MBP-related transcripts and gene products. The Golli mRNAs contain 3 exons unique to Golli-MBP, spliced in-frame to 1 or more MBP exons. They encode hybrid proteins that have N-terminal Golli aa sequence linked to MBP aa sequence. The second family of transcripts contain only MBP exons and produce the well characterized myelin basic proteins. This complex gene structure is conserved among species suggesting that the MBP transcription unit is an integral part of the Golli transcription unit and that this arrangement is important for the function and/or regulation of these genes. [provided by RefSeq, Jul 2008]
Mouse(17196) myelin basic protein
Rat(24547) myelin basic protein
chicken(396217) myelin basic protein
domestic cat(101096421) myelin basic protein
dog(476160) myelin basic protein
cow(618684) myelin basic protein
naked mole-rat(101702488) myelin basic protein
domestic guinea pig(100731253) myelin basic protein
sheep(101109407) myelin basic protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108749 Anti-MBP affinity isolated antibody dog, guinea pig, rabbit, human, horse, rat
western blot pricing
SAB2104171 Anti-MBP antibody produced in rabbit affinity isolated antibody canine, horse, guinea pig, human, pig, bovine, mouse, rat, rabbit, rabbit
western blot pricing
SAB2104172 Anti-MBP antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, immunoprecipitation (IP), western blot pricing
HPA049222 Anti-MBP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human
immunohistochemistry, western blot pricing
HPA064368 Anti-MBP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
M3821 Anti-Myelin Basic Protein (MBP) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, mouse, rat
flow cytometry, immunohistochemistry, western blot pricing
SAB5300427 Monoclonal Anti-MBP antibody produced in mouse clone 2H9, ascites fluid human
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
AMAB91062 Monoclonal Anti-MBP antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2819, purified immunoglobulin, buffered aqueous glycerol solution rat, mouse, human
immunohistochemistry, western blot pricing
AMAB91063 Monoclonal Anti-MBP antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2827, purified immunoglobulin, buffered aqueous glycerol solution human, rat, mouse
immunohistochemistry, western blot pricing
AMAB91064 Monoclonal Anti-MBP antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2829, purified immunoglobulin, buffered aqueous glycerol solution rat, human, mouse
immunohistochemistry, western blot pricing
M9434 Monoclonal Anti-Myelin Basic Protein (MBP) (36-50) antibody produced in rat clone 14, tissue culture supernatant horse, chicken, human
ELISA, immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001025098 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001025098 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001025098 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001025245 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025245 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025245 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU095491 MISSION® esiRNA esiRNA human MBP (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
CBL419 Anti-Eosinophil Major Basic Protein Antibody, clone BMK13 Anti-Eosinophil Major Basic Protein Antibody, clone BMK13 is an antibody against Eosinophil Major Basic Protein for use in ELISA, WB, IH(P). pricing
05-675 Anti-MBP Antibody, clone SKB3 Detect MBP using this Anti-MBP Antibody, clone SKB3 validated for use in WB. pricing
MAB387-1ML Anti-Myelin Basic Protein (84-89) Antibody This Anti-Myelin Basic Protein (84-89) Antibody is validated for use in IH for the detection of Myelin Basic Protein (84-89). pricing
MAB387 Anti-Myelin Basic Protein (84-89) Antibody This Anti-Myelin Basic Protein (84-89) Antibody is validated for use in IH for the detection of Myelin Basic Protein (84-89). pricing
AB15542 Anti-Myelin Basic protein Antibody Detect Myelin Basic protein using this Anti-Myelin Basic protein Antibody validated for use in WB. pricing
AB5864 Anti-Myelin Basic Protein Antibody Anti-Myelin Basic Protein Antibody is an antibody against Myelin Basic Protein for use in IH. pricing
AB9348 Anti-Myelin Basic Protein Antibody Anti-Myelin Basic Protein Antibody detects level of Myelin Basic Protein & has been published & validated for use in IC, IH. pricing
AB980 Anti-Myelin Basic Protein Antibody This Anti-Myelin Basic Protein Antibody is validated for use in IH, IH(P), WB for the detection of Myelin Basic Protein. pricing
MAB381 Anti-Myelin Basic Protein Antibody, a.a. 119-131, clone 2 Anti-Myelin Basic Protein Antibody, a.a. 119-131, clone 2 is an antibody against Myelin Basic Protein for use in ELISA, IH. pricing
MAB382 Anti-Myelin Basic Protein Antibody, a.a. 129-138, clone 1 This Anti-Myelin Basic Protein Antibody, a.a. 129-138, clone 1 is validated for use in ELISA, IH, IH(P), RIA, WB for the detection of Myelin Basic Protein. pricing
MAB395 Anti-Myelin Basic Protein Antibody, a.a. 36-50, clone 14 Detect Myelin Basic Protein using this Anti-Myelin Basic Protein Antibody, a.a. 36-50, clone 14 validated for use in ELISA, IH. pricing
MAB395-1ML Anti-Myelin Basic Protein Antibody, a.a. 36-50, clone 14 Detect Myelin Basic Protein using this Anti-Myelin Basic Protein Antibody, a.a. 36-50, clone 14 validated for use in ELISA, IH. pricing
MAB384-1ML Anti-Myelin Basic Protein Antibody, a.a. 67-74, clone 26 Anti-Myelin Basic Protein Antibody, a.a. 67-74, clone 26 detects level of Myelin Basic Protein & has been published & validated for use in WB, IH. pricing
MAB386 Anti-Myelin Basic Protein Antibody, a.a. 82-87 Anti-Myelin Basic Protein Antibody, a.a. 82-87 is an antibody against Myelin Basic Protein for use in ELISA, IC, IH, RIA & WB. pricing
05-429 Anti-phospho-MBP Antibody, clone P12 Detect phospho-MBP using this Anti-phospho-MBP Antibody, clone P12 validated for use in EA & WB. pricing
16-206 Anti-phospho-MBP Antibody, HRP conjugate Anti-phospho-MBP Antibody, HRP conjugate is an antibody against phospho-MBP for use in ELISA & IP. pricing
13-111 MBP, biotin conjugate pricing
13-110 MBP, Dephosphorylated pricing
13-104 MBP (myelin basic protein), bovine, purified pricing
13-173 MBP, recombinant pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025081 Rosetta Predictions human pricing
NM_001025090 Rosetta Predictions human pricing
NM_001025092 Rosetta Predictions human pricing
NM_001025094 Rosetta Predictions human pricing
NM_001025098 Rosetta Predictions human pricing
NM_001025100 Rosetta Predictions human pricing
NM_001025101 Rosetta Predictions human pricing
NM_002385 Rosetta Predictions human pricing
NM_001025289 Rosetta Predictions rat pricing
NM_001025291 Rosetta Predictions rat pricing
NM_001025292 Rosetta Predictions rat pricing
NM_001025293 Rosetta Predictions rat pricing
NM_001025294 Rosetta Predictions rat pricing
NM_017026 Rosetta Predictions rat pricing
NM_001025245 Rosetta Predictions mouse pricing
NM_001025251 Rosetta Predictions mouse pricing
NM_001025254 Rosetta Predictions mouse pricing
NM_001025255 Rosetta Predictions mouse pricing
NM_001025256 Rosetta Predictions mouse pricing
NM_001025258 Rosetta Predictions mouse pricing
NM_001025259 Rosetta Predictions mouse pricing
NM_010777 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025081 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150875 predicted 756
2 SASI_Hs01_00150877 predicted 797
3 SASI_Hs01_00150876 predicted 852
4 SASI_Hs01_00150878 predicted 1164
5 SASI_Hs01_00150879 predicted 393
6 SASI_Hs01_00150880 predicted 696
7 SASI_Hs01_00150881 predicted 843
8 SASI_Hs02_00307325 predicted 703
9 SASI_Hs01_00150882 predicted 425
10 SASI_Hs01_00150883 predicted 493
11 SASI_Hs01_00150884 predicted 189
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025090 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065865 predicted 675
2 SASI_Hs01_00065867 predicted 723
3 SASI_Hs01_00065866 predicted 781
4 SASI_Hs01_00065868 predicted 1079
5 SASI_Hs01_00065869 predicted 311
6 SASI_Hs01_00065870 predicted 622
7 SASI_Hs02_00307356 predicted 769
8 SASI_Hs01_00065871 predicted 758
9 SASI_Hs02_00307357 predicted 627
10 SASI_Hs01_00065872 predicted 340
11 SASI_Hs01_00065873 predicted 413
12 SASI_Hs01_00065874 predicted 267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025092 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166003 predicted 643
2 SASI_Hs01_00166005 predicted 687
3 SASI_Hs01_00166004 predicted 741
4 SASI_Hs01_00166006 predicted 1049
5 SASI_Hs01_00166007 predicted 313
6 SASI_Hs01_00166008 predicted 583
7 SASI_Hs02_00307361 predicted 740
8 SASI_Hs01_00166009 predicted 727
9 SASI_Hs01_00166010 predicted 590
10 SASI_Hs01_00166011 predicted 349
11 SASI_Hs01_00166012 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025094 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183992 predicted 684
2 SASI_Hs01_00183993 predicted 785
3 SASI_Hs01_00183994 predicted 730
4 SASI_Hs01_00183995 predicted 322
5 SASI_Hs01_00183996 predicted 628
6 SASI_Hs01_00183997 predicted 780
7 SASI_Hs01_00183998 predicted 642
8 SASI_Hs01_00183999 predicted 355
9 SASI_Hs01_00184000 predicted 274
10 SASI_Hs01_00184001 predicted 187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025098 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047490 predicted 655
2 SASI_Hs01_00047491 predicted 752
3 SASI_Hs01_00047492 predicted 702
4 SASI_Hs01_00047493 predicted 324
5 SASI_Hs01_00047494 predicted 595
6 SASI_Hs01_00047495 predicted 747
7 SASI_Hs01_00047496 predicted 605
8 SASI_Hs01_00047497 predicted 351
9 SASI_Hs01_00047498 predicted 266
10 SASI_Hs01_00047499 predicted 187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025100 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011618 predicted 356
2 SASI_Hs01_00011619 predicted 305
3 SASI_Hs01_00011620 predicted 299
4 SASI_Hs01_00011621 predicted 451
5 SASI_Hs01_00011622 predicted 352
6 SASI_Hs01_00011623 predicted 270
7 SASI_Hs01_00011624 predicted 364
8 SASI_Hs01_00011625 predicted 360
9 SASI_Hs01_00011626 predicted 350
10 SASI_Hs01_00011627 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025101 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140407 predicted 1250
2 SASI_Hs01_00140409 predicted 1289
3 SASI_Hs01_00140408 predicted 1344
4 SASI_Hs01_00140412 predicted 308
5 SASI_Hs01_00140413 predicted 385
6 SASI_Hs01_00140416 predicted 1332
7 SASI_Hs02_00307365 predicted 1211
8 SASI_Hs02_00307366 predicted 320
9 SASI_Hs02_00307367 predicted 917
10 SASI_Hs01_00140410 predicted 653
11 SASI_Hs01_00140411 predicted 1565
12 SASI_Hs01_00140414 predicted 657
13 SASI_Hs01_00140415 predicted 844
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002385 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190796 predicted 721
2 SASI_Hs01_00190798 predicted 760
3 SASI_Hs01_00190797 predicted 817
4 SASI_Hs01_00190799 predicted 1129
5 SASI_Hs01_00190800 predicted 395
6 SASI_Hs01_00190801 predicted 667
7 SASI_Hs01_00190802 predicted 808
8 SASI_Hs01_00190803 predicted 672
9 SASI_Hs01_00190804 predicted 423
10 SASI_Hs02_00333733 predicted 341
11 SASI_Hs01_00190805 predicted 197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025289 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103810 predicted 1063
2 SASI_Rn02_00203118 predicted 735
3 SASI_Rn01_00103811 predicted 1037
4 SASI_Rn01_00103812 predicted 1106
5 SASI_Rn01_00103813 predicted 376
6 SASI_Rn01_00103814 predicted 247
7 SASI_Rn01_00103815 predicted 275
8 SASI_Rn01_00103816 predicted 441
9 SASI_Rn01_00103817 predicted 902
10 SASI_Rn01_00103818 predicted 318
11 SASI_Rn01_00103819 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025291 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082424 predicted 686
2 SASI_Rn01_00082425 predicted 398
3 SASI_Rn02_00203119 predicted 168
4 SASI_Rn01_00082426 predicted 742
5 SASI_Rn01_00082428 predicted 709
6 SASI_Rn02_00203120 predicted 1133
7 SASI_Rn01_00082430 predicted 336
8 SASI_Rn01_00082432 predicted 511
9 SASI_Rn02_00203121 predicted 1132
10 SASI_Rn02_00203122 predicted 192
11 SASI_Rn01_00082427 predicted 403
12 SASI_Rn01_00082429 predicted 328
13 SASI_Rn01_00082431 predicted 723
14 SASI_Rn01_00082433 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025292 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031891 predicted 606
2 SASI_Rn01_00031892 predicted 323
3 SASI_Rn01_00031893 predicted 667
4 SASI_Rn01_00031894 predicted 322
5 SASI_Rn01_00031895 predicted 635
6 SASI_Rn02_00203123 predicted 1053
7 SASI_Rn01_00031897 predicted 256
8 SASI_Rn01_00031898 predicted 636
9 SASI_Rn01_00031899 predicted 241
10 SASI_Rn02_00203124 predicted 435
11 SASI_Rn01_00031896 predicted 640
12 SASI_Rn01_00031900 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025293 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064902 predicted 555
2 SASI_Rn01_00064903 predicted 397
3 SASI_Rn01_00064904 predicted 614
4 SASI_Rn01_00064905 predicted 399
5 SASI_Rn01_00064906 predicted 590
6 SASI_Rn02_00203125 predicted 1011
7 SASI_Rn01_00064909 predicted 330
8 SASI_Rn01_00064910 predicted 591
9 SASI_Rn02_00203126 predicted 326
10 SASI_Rn02_00203127 predicted 1008
11 SASI_Rn01_00064907 predicted 334
12 SASI_Rn01_00064908 predicted 592
13 SASI_Rn01_00064911 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025294 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110065 predicted 575
2 SASI_Rn01_00110066 predicted 320
3 SASI_Rn01_00110067 predicted 628
4 SASI_Rn01_00110068 predicted 322
5 SASI_Rn01_00110069 predicted 597
6 SASI_Rn02_00203128 predicted 1019
7 SASI_Rn01_00110071 predicted 260
8 SASI_Rn01_00110072 predicted 600
9 SASI_Rn01_00110073 predicted 241
10 SASI_Rn02_00203129 predicted 405
11 SASI_Rn01_00110070 predicted 612
12 SASI_Rn01_00110074 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017026 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117435 predicted 480
2 SASI_Rn01_00117436 predicted 317
3 SASI_Rn01_00117437 predicted 536
4 SASI_Rn01_00117438 predicted 322
5 SASI_Rn01_00117439 predicted 511
6 SASI_Rn01_00117441 predicted 512
7 SASI_Rn01_00117443 predicted 251
8 SASI_Rn01_00117444 predicted 511
9 SASI_Rn02_00261202 predicted 242
10 SASI_Rn02_00261203 predicted 317
11 SASI_Rn01_00117440 predicted 253
12 SASI_Rn01_00117442 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025245 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124882 predicted 497
2 SASI_Mm01_00124885 predicted 319
3 SASI_Mm01_00124886 predicted 323
4 SASI_Mm01_00124887 predicted 496
5 SASI_Mm02_00287802 predicted 640
6 SASI_Mm01_00124888 predicted 507
7 SASI_Mm01_00124889 predicted 589
8 SASI_Mm01_00124890 predicted 606
9 SASI_Mm01_00124891 predicted 379
10 SASI_Mm02_00287803 predicted 524
11 SASI_Mm01_00124883 predicted 339
12 SASI_Mm01_00124884 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025251 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153126 predicted 1177
2 SASI_Mm01_00153119 predicted 777
3 SASI_Mm01_00153120 predicted 720
4 SASI_Mm02_00287804 predicted 439
5 SASI_Mm01_00153121 predicted 1166
6 SASI_Mm01_00153122 predicted 370
7 SASI_Mm01_00153124 predicted 558
8 SASI_Mm01_00153125 predicted 204
9 SASI_Mm01_00153127 predicted 274
10 SASI_Mm01_00153128 predicted 357
11 SASI_Mm01_00153123 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025254 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171296 predicted 1099
2 SASI_Mm01_00171289 predicted 700
3 SASI_Mm01_00171290 predicted 646
4 SASI_Mm02_00287805 predicted 397
5 SASI_Mm01_00171291 predicted 1087
6 SASI_Mm01_00171292 predicted 325
7 SASI_Mm01_00171294 predicted 479
8 SASI_Mm01_00171295 predicted 165
9 SASI_Mm01_00171297 predicted 235
10 SASI_Mm01_00171298 predicted 309
11 SASI_Mm01_00171293 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025255 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133638 predicted 1093
2 SASI_Mm01_00133631 predicted 706
3 SASI_Mm01_00133632 predicted 647
4 SASI_Mm02_00287806 predicted 364
5 SASI_Mm01_00133633 predicted 1092
6 SASI_Mm01_00133634 predicted 285
7 SASI_Mm01_00133636 predicted 476
8 SASI_Mm01_00133637 predicted 211
9 SASI_Mm01_00133639 predicted 282
10 SASI_Mm01_00133640 predicted 665
11 SASI_Mm01_00133635 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025256 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092002 predicted 1051
2 SASI_Mm01_00091996 predicted 657
3 SASI_Mm01_00091997 predicted 602
4 SASI_Mm02_00287807 predicted 436
5 SASI_Mm01_00091998 predicted 1045
6 SASI_Mm01_00091999 predicted 367
7 SASI_Mm01_00092001 predicted 206
8 SASI_Mm01_00092003 predicted 274
9 SASI_Mm01_00092004 predicted 360
10 SASI_Mm01_00092005 predicted 617
11 SASI_Mm01_00092000 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025258 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081397 predicted 1065
2 SASI_Mm01_00081390 predicted 666
3 SASI_Mm01_00081391 predicted 615
4 SASI_Mm02_00287809 predicted 364
5 SASI_Mm01_00081392 predicted 1058
6 SASI_Mm01_00081393 predicted 293
7 SASI_Mm01_00081395 predicted 445
8 SASI_Mm01_00081396 predicted 202
9 SASI_Mm01_00081398 predicted 275
10 SASI_Mm01_00081399 predicted 635
11 SASI_Mm01_00081394 predicted 294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025259 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118418 predicted 976
2 SASI_Mm01_00118412 predicted 577
3 SASI_Mm01_00118413 predicted 520
4 SASI_Mm02_00287810 predicted 357
5 SASI_Mm01_00118414 predicted 970
6 SASI_Mm01_00118415 predicted 286
7 SASI_Mm01_00118416 predicted 282
8 SASI_Mm01_00118417 predicted 207
9 SASI_Mm01_00118419 predicted 284
10 SASI_Mm01_00118421 predicted 538
11 SASI_Mm01_00118420 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010777 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319326 predicted 1513
2 SASI_Mm01_00115585 predicted 620
3 SASI_Mm01_00115586 predicted 1127
4 SASI_Mm01_00115587 predicted 499
5 SASI_Mm01_00115588 predicted 333
6 SASI_Mm01_00115590 predicted 687
7 SASI_Mm01_00115591 predicted 326
8 SASI_Mm01_00115592 predicted 330
9 SASI_Mm01_00115594 predicted 496
10 SASI_Mm02_00319327 predicted 866
11 SASI_Mm01_00115589 predicted 511
12 SASI_Mm01_00115593 predicted 946
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025098
MBP MISSION shRNA Bacterial Glycerol Stock
myelin basic protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025098.1-349s1c1
Sequence:CCGGCGTAGTCCACTTCTTCAAGAACTCGAGTTCTTGAAGAAGTGGACTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025098.1-136s1c1
Sequence:CCGGCCTGGCCACAGCAAGTACCATCTCGAGATGGTACTTGCTGTGGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025098.1-449s1c1
Sequence:CCGGCGGAGGCAGAGCGTCCGACTACTCGAGTAGTCGGACGCTCTGCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025098.1-280s1c1
Sequence:CCGGCCCGGCAAGAACTGCTCACTACTCGAGTAGTGAGCAGTTCTTGCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116257    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025098.1-1969s1c1
Sequence:CCGGGCCTCGATGATGAGAGAGTTACTCGAGTAACTCTCTCATCATCGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025098
MBP MISSION shRNA shRNA Plasmid DNA
myelin basic protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025098.1-349s1c1
Sequence:CCGGCGTAGTCCACTTCTTCAAGAACTCGAGTTCTTGAAGAAGTGGACTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025098.1-136s1c1
Sequence:CCGGCCTGGCCACAGCAAGTACCATCTCGAGATGGTACTTGCTGTGGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025098.1-449s1c1
Sequence:CCGGCGGAGGCAGAGCGTCCGACTACTCGAGTAGTCGGACGCTCTGCCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025098.1-280s1c1
Sequence:CCGGCCCGGCAAGAACTGCTCACTACTCGAGTAGTGAGCAGTTCTTGCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116257    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025098.1-1969s1c1
Sequence:CCGGGCCTCGATGATGAGAGAGTTACTCGAGTAACTCTCTCATCATCGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025098
MBP MISSION shRNA Lentiviral Transduction Particles
myelin basic protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025098.1-349s1c1
Sequence:CCGGCGTAGTCCACTTCTTCAAGAACTCGAGTTCTTGAAGAAGTGGACTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025098.1-136s1c1
Sequence:CCGGCCTGGCCACAGCAAGTACCATCTCGAGATGGTACTTGCTGTGGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025098.1-449s1c1
Sequence:CCGGCGGAGGCAGAGCGTCCGACTACTCGAGTAGTCGGACGCTCTGCCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025098.1-280s1c1
Sequence:CCGGCCCGGCAAGAACTGCTCACTACTCGAGTAGTGAGCAGTTCTTGCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116257    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025098.1-1969s1c1
Sequence:CCGGGCCTCGATGATGAGAGAGTTACTCGAGTAACTCTCTCATCATCGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025245
VALIDATED
MBP MISSION shRNA Bacterial Glycerol Stock
myelin basic protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376806    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001025245.1-1170s21c1
Sequence:CCGGCCTATGGGTTCTTAGGTATACCTCGAGGTATACCTAAGAACCCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025245.1-883s21c1
Sequence:CCGGTAGAGAAGCTGTGGGTTTAAACTCGAGTTTAAACCCACAGCTTCTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025245.1-511s1c1
Sequence:CCGGGACCCAAAGAATAACTGGCAACTCGAGTTGCCAGTTATTCTTTGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001025245.1-640s1c1
Sequence:CCGGGACGAGCTTCAGACCATCCAACTCGAGTTGGATGGTCTGAAGCTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025245.1-742s1c1
Sequence:CCGGACAGCAAGTACCATGGACCATCTCGAGATGGTCCATGGTACTTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001025245.1-340s1c1
Sequence:CCGGGCCAGTAAGGATGGAGAGATTCTCGAGAATCTCTCCATCCTTACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025245.1-1300s1c1
Sequence:CCGGGCTGTGAAACAATGGTCCAATCTCGAGATTGGACCATTGTTTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025245.1-443s21c1
Sequence:CCGGCAGATGCGATCCAGAACAATGCTCGAGCATTGTTCTGGATCGCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025245.1-602s21c1
Sequence:CCGGGGGAGGACAACACCTTCAAAGCTCGAGCTTTGAAGGTGTTGTCCTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001025245.1-714s21c1
Sequence:CCGGACCCTCACAGCGATCCAAGTACTCGAGTACTTGGATCGCTGTGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025245
VALIDATED
MBP MISSION shRNA shRNA Plasmid DNA
myelin basic protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376806    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001025245.1-1170s21c1
Sequence:CCGGCCTATGGGTTCTTAGGTATACCTCGAGGTATACCTAAGAACCCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025245.1-883s21c1
Sequence:CCGGTAGAGAAGCTGTGGGTTTAAACTCGAGTTTAAACCCACAGCTTCTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025245.1-511s1c1
Sequence:CCGGGACCCAAAGAATAACTGGCAACTCGAGTTGCCAGTTATTCTTTGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001025245.1-640s1c1
Sequence:CCGGGACGAGCTTCAGACCATCCAACTCGAGTTGGATGGTCTGAAGCTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025245.1-742s1c1
Sequence:CCGGACAGCAAGTACCATGGACCATCTCGAGATGGTCCATGGTACTTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001025245.1-340s1c1
Sequence:CCGGGCCAGTAAGGATGGAGAGATTCTCGAGAATCTCTCCATCCTTACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025245.1-1300s1c1
Sequence:CCGGGCTGTGAAACAATGGTCCAATCTCGAGATTGGACCATTGTTTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025245.1-443s21c1
Sequence:CCGGCAGATGCGATCCAGAACAATGCTCGAGCATTGTTCTGGATCGCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025245.1-602s21c1
Sequence:CCGGGGGAGGACAACACCTTCAAAGCTCGAGCTTTGAAGGTGTTGTCCTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001025245.1-714s21c1
Sequence:CCGGACCCTCACAGCGATCCAAGTACTCGAGTACTTGGATCGCTGTGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025245
VALIDATED
MBP MISSION shRNA Lentiviral Transduction Particles
myelin basic protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376806    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001025245.1-1170s21c1
Sequence:CCGGCCTATGGGTTCTTAGGTATACCTCGAGGTATACCTAAGAACCCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025245.1-883s21c1
Sequence:CCGGTAGAGAAGCTGTGGGTTTAAACTCGAGTTTAAACCCACAGCTTCTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025245.1-511s1c1
Sequence:CCGGGACCCAAAGAATAACTGGCAACTCGAGTTGCCAGTTATTCTTTGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001025245.1-640s1c1
Sequence:CCGGGACGAGCTTCAGACCATCCAACTCGAGTTGGATGGTCTGAAGCTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025245.1-742s1c1
Sequence:CCGGACAGCAAGTACCATGGACCATCTCGAGATGGTCCATGGTACTTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001025245.1-340s1c1
Sequence:CCGGGCCAGTAAGGATGGAGAGATTCTCGAGAATCTCTCCATCCTTACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025245.1-1300s1c1
Sequence:CCGGGCTGTGAAACAATGGTCCAATCTCGAGATTGGACCATTGTTTCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025245.1-443s21c1
Sequence:CCGGCAGATGCGATCCAGAACAATGCTCGAGCATTGTTCTGGATCGCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025245.1-602s21c1
Sequence:CCGGGGGAGGACAACACCTTCAAAGCTCGAGCTTTGAAGGTGTTGTCCTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001025245.1-714s21c1
Sequence:CCGGACCCTCACAGCGATCCAAGTACTCGAGTACTTGGATCGCTGTGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)