EMAIL THIS PAGE TO A FRIEND

MBTD1

mbt domain containing 1

164 Gene Product Result for
Synonyms: SA49P01
UniProtKB ID: Q05BQ5, Q6ZVU7, Q9NXU1
Gene ID:
Mouse(103537) mbt domain containing 1
Rat(688133) mbt domain containing 1
chicken(417387) mbt domain containing 1
dog(491087) mbt domain containing 1
domestic cat(101087949) mbt domain containing 1
cow(511415) mbt domain containing 1
Horse(100070259) mbt domain containing 1
sheep(101123644) mbt domain containing 1
domestic guinea pig(100725560) mbt domain containing 1
naked mole-rat(101725217) mbt domain containing 1
Domestic Rabbit(100339339) mbt domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017643 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017643 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017643 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134012 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134012 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134012 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU057311 MISSION® esiRNA esiRNA human MBTD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017643 Rosetta Predictions human pricing
XM_001081155 Rosetta Predictions rat pricing
XM_001081161 Rosetta Predictions rat pricing
XM_001081163 Rosetta Predictions rat pricing
XM_001081166 Rosetta Predictions rat pricing
XM_001081168 Rosetta Predictions rat pricing
NM_134012 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039451 predicted 1330
2 SASI_Hs02_00350336 predicted 1491
3 SASI_Hs02_00350337 predicted 1193
4 SASI_Hs01_00039454 predicted 1073
5 SASI_Hs01_00039457 predicted 1171
6 SASI_Hs01_00039458 predicted 1699
7 SASI_Hs01_00039459 predicted 1986
8 SASI_Hs02_00350338 predicted 1275
9 SASI_Hs02_00350339 predicted 1606
10 SASI_Hs02_00350340 predicted 1372
11 SASI_Hs01_00039452 predicted 517
12 SASI_Hs01_00039453 predicted 1447
13 SASI_Hs01_00039455 predicted 772
14 SASI_Hs01_00039456 predicted 1427
15 SASI_Hs01_00039460 predicted 1485
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081155 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370771 predicted 1367
2 SASI_Rn02_00370772 predicted 2055
3 SASI_Rn02_00370773 predicted 387
4 SASI_Rn02_00370774 predicted 2152
5 SASI_Rn02_00370775 predicted 928
6 SASI_Rn02_00370776 predicted 1406
7 SASI_Rn02_00370777 predicted 1041
8 SASI_Rn02_00370778 predicted 546
9 SASI_Rn02_00370779 predicted 553
10 SASI_Rn02_00370780 predicted 1345
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081161 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370811 predicted 1319
2 SASI_Rn02_00370812 predicted 347
3 SASI_Rn02_00370813 predicted 882
4 SASI_Rn02_00370814 predicted 1356
5 SASI_Rn02_00370815 predicted 995
6 SASI_Rn02_00370816 predicted 1101
7 SASI_Rn02_00370817 predicted 499
8 SASI_Rn02_00370818 predicted 503
9 SASI_Rn02_00370819 predicted 1298
10 SASI_Rn02_00370820 predicted 1811
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081163 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370831 predicted 1305
2 SASI_Rn02_00370832 predicted 341
3 SASI_Rn02_00370833 predicted 873
4 SASI_Rn02_00370834 predicted 1349
5 SASI_Rn02_00370835 predicted 987
6 SASI_Rn02_00370836 predicted 1098
7 SASI_Rn02_00370837 predicted 491
8 SASI_Rn02_00370838 predicted 497
9 SASI_Rn02_00370839 predicted 1291
10 SASI_Rn02_00370840 predicted 1805
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081166 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370861 predicted 1252
2 SASI_Rn02_00370862 predicted 286
3 SASI_Rn02_00370863 predicted 819
4 SASI_Rn02_00370864 predicted 1296
5 SASI_Rn02_00370865 predicted 930
6 SASI_Rn02_00370866 predicted 1040
7 SASI_Rn02_00370867 predicted 436
8 SASI_Rn02_00370868 predicted 451
9 SASI_Rn02_00370869 predicted 1230
10 SASI_Rn02_00370870 predicted 1752
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081168 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370871 predicted 1293
2 SASI_Rn02_00370872 predicted 322
3 SASI_Rn02_00370873 predicted 861
4 SASI_Rn02_00370874 predicted 1332
5 SASI_Rn02_00370875 predicted 974
6 SASI_Rn02_00370876 predicted 1080
7 SASI_Rn02_00370877 predicted 478
8 SASI_Rn02_00370878 predicted 490
9 SASI_Rn02_00370879 predicted 1272
10 SASI_Rn02_00370880 predicted 1784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134012 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059000 predicted 1260
2 SASI_Mm02_00339160 predicted 977
3 SASI_Mm01_00059002 predicted 1284
4 SASI_Mm01_00059003 predicted 1085
5 SASI_Mm01_00059004 predicted 1094
6 SASI_Mm01_00059005 predicted 1773
7 SASI_Mm01_00059006 predicted 1898
8 SASI_Mm01_00059008 predicted 913
9 SASI_Mm02_00339161 predicted 490
10 SASI_Mm01_00059009 predicted 1792
11 SASI_Mm01_00059001 predicted 1315
12 SASI_Mm01_00059007 predicted 1296
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017643
VALIDATED
MBTD1 MISSION shRNA Bacterial Glycerol Stock
mbt domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017643.2-1878s21c1
Sequence:CCGGGCCACAGTAACTCGAATTATTCTCGAGAATAATTCGAGTTACTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017643.1-407s1c1
Sequence:CCGGCTCCTAGAACTATTCAGCATACTCGAGTATGCTGAATAGTTCTAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017643.1-1210s1c1
Sequence:CCGGGCCACAGTAACTCGAATTATTCTCGAGAATAATTCGAGTTACTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017643.1-406s1c1
Sequence:CCGGCCTCCTAGAACTATTCAGCATCTCGAGATGCTGAATAGTTCTAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017643.2-1850s21c1
Sequence:CCGGTCTCATGGAGCCACGTTTAATCTCGAGATTAAACGTGGCTCCATGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017643.2-1348s21c1
Sequence:CCGGGCCCATTAATACATCATATTGCTCGAGCAATATGATGTATTAATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153466    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017643.1-1416s1c1
Sequence:CCGGCCAGAGGACTATCTCACATAACTCGAGTTATGTGAGATAGTCCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017643.1-886s1c1
Sequence:CCGGGCAACCATTAGAAAGGTGCTACTCGAGTAGCACCTTTCTAATGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017643.2-1514s21c1
Sequence:CCGGGGAAGCTATAGACCCATTAAACTCGAGTTTAATGGGTCTATAGCTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017643.2-2489s21c1
Sequence:CCGGTGGATTTATGTGCATTGTTAACTCGAGTTAACAATGCACATAAATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017643
VALIDATED
MBTD1 MISSION shRNA shRNA Plasmid DNA
mbt domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017643.2-1878s21c1
Sequence:CCGGGCCACAGTAACTCGAATTATTCTCGAGAATAATTCGAGTTACTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017643.1-407s1c1
Sequence:CCGGCTCCTAGAACTATTCAGCATACTCGAGTATGCTGAATAGTTCTAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017643.1-1210s1c1
Sequence:CCGGGCCACAGTAACTCGAATTATTCTCGAGAATAATTCGAGTTACTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017643.1-406s1c1
Sequence:CCGGCCTCCTAGAACTATTCAGCATCTCGAGATGCTGAATAGTTCTAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017643.2-1850s21c1
Sequence:CCGGTCTCATGGAGCCACGTTTAATCTCGAGATTAAACGTGGCTCCATGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017643.2-1348s21c1
Sequence:CCGGGCCCATTAATACATCATATTGCTCGAGCAATATGATGTATTAATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153466    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017643.1-1416s1c1
Sequence:CCGGCCAGAGGACTATCTCACATAACTCGAGTTATGTGAGATAGTCCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017643.1-886s1c1
Sequence:CCGGGCAACCATTAGAAAGGTGCTACTCGAGTAGCACCTTTCTAATGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017643.2-1514s21c1
Sequence:CCGGGGAAGCTATAGACCCATTAAACTCGAGTTTAATGGGTCTATAGCTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017643.2-2489s21c1
Sequence:CCGGTGGATTTATGTGCATTGTTAACTCGAGTTAACAATGCACATAAATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017643
VALIDATED
MBTD1 MISSION shRNA Lentiviral Transduction Particles
mbt domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017643.2-1878s21c1
Sequence:CCGGGCCACAGTAACTCGAATTATTCTCGAGAATAATTCGAGTTACTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017643.1-407s1c1
Sequence:CCGGCTCCTAGAACTATTCAGCATACTCGAGTATGCTGAATAGTTCTAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017643.1-1210s1c1
Sequence:CCGGGCCACAGTAACTCGAATTATTCTCGAGAATAATTCGAGTTACTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017643.1-406s1c1
Sequence:CCGGCCTCCTAGAACTATTCAGCATCTCGAGATGCTGAATAGTTCTAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017643.2-1850s21c1
Sequence:CCGGTCTCATGGAGCCACGTTTAATCTCGAGATTAAACGTGGCTCCATGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017643.2-1348s21c1
Sequence:CCGGGCCCATTAATACATCATATTGCTCGAGCAATATGATGTATTAATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153466    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017643.1-1416s1c1
Sequence:CCGGCCAGAGGACTATCTCACATAACTCGAGTTATGTGAGATAGTCCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017643.1-886s1c1
Sequence:CCGGGCAACCATTAGAAAGGTGCTACTCGAGTAGCACCTTTCTAATGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017643.2-1514s21c1
Sequence:CCGGGGAAGCTATAGACCCATTAAACTCGAGTTTAATGGGTCTATAGCTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017643.2-2489s21c1
Sequence:CCGGTGGATTTATGTGCATTGTTAACTCGAGTTAACAATGCACATAAATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134012
MBTD1 MISSION shRNA Bacterial Glycerol Stock
mbt domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134012.1-620s1c1
Sequence:CCGGGAGATCAGATATTACGAAGAACTCGAGTTCTTCGTAATATCTGATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134012.1-1121s1c1
Sequence:CCGGCCGTCTCTTGAGGATACATTTCTCGAGAAATGTATCCTCAAGAGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134012.1-1759s1c1
Sequence:CCGGGCAGGATTGAAGGAAATGATTCTCGAGAATCATTTCCTTCAATCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134012.1-1041s1c1
Sequence:CCGGCGTGTAGGAATGAAATTAGAACTCGAGTTCTAATTTCATTCCTACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134012.1-229s1c1
Sequence:CCGGGCAATATATGTGGGTCTGATACTCGAGTATCAGACCCACATATATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134012
MBTD1 MISSION shRNA shRNA Plasmid DNA
mbt domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134012.1-620s1c1
Sequence:CCGGGAGATCAGATATTACGAAGAACTCGAGTTCTTCGTAATATCTGATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134012.1-1121s1c1
Sequence:CCGGCCGTCTCTTGAGGATACATTTCTCGAGAAATGTATCCTCAAGAGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134012.1-1759s1c1
Sequence:CCGGGCAGGATTGAAGGAAATGATTCTCGAGAATCATTTCCTTCAATCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134012.1-1041s1c1
Sequence:CCGGCGTGTAGGAATGAAATTAGAACTCGAGTTCTAATTTCATTCCTACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134012.1-229s1c1
Sequence:CCGGGCAATATATGTGGGTCTGATACTCGAGTATCAGACCCACATATATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134012
MBTD1 MISSION shRNA Lentiviral Transduction Particles
mbt domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134012.1-620s1c1
Sequence:CCGGGAGATCAGATATTACGAAGAACTCGAGTTCTTCGTAATATCTGATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134012.1-1121s1c1
Sequence:CCGGCCGTCTCTTGAGGATACATTTCTCGAGAAATGTATCCTCAAGAGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134012.1-1759s1c1
Sequence:CCGGGCAGGATTGAAGGAAATGATTCTCGAGAATCATTTCCTTCAATCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134012.1-1041s1c1
Sequence:CCGGCGTGTAGGAATGAAATTAGAACTCGAGTTCTAATTTCATTCCTACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134012.1-229s1c1
Sequence:CCGGGCAATATATGTGGGTCTGATACTCGAGTATCAGACCCACATATATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)