EMAIL THIS PAGE TO A FRIEND

MBTPS1

membrane-bound transcription factor peptidase, site 1

90 Gene Product Result for
Synonyms: PCSK8 S1P SKI-1
UniProtKB ID: Q14703, Q24JQ2, Q9UF67
Gene ID:
Human(8720) Summary: The encoded protein has a central role in the regulation of lipid metabolism in cells. It is a sterol-regulated subtilisin-like serine protease that cleaves ER membrane-bound sterol regulatory element-binding proteins (SREBPs), a reaction that initiates the two-step proteolytic process by which transcriptionally active fragments of SREBPs are released from the membrane for translocation to the nucleus. The gene product is an integral membrane ER protein, with the bulk located in the ER lumen. It is synthesized as an inactive preproprotein that is self-activated by an intramolecular cleavage that generates the mature protein. [provided by RefSeq, Jul 2008]
Mouse(56453) membrane-bound transcription factor peptidase, site 1
Rat(89842) membrane-bound transcription factor peptidase, site 1
naked mole-rat(101713902) membrane-bound transcription factor peptidase, site 1
domestic guinea pig(100727902) membrane-bound transcription factor peptidase, site 1
sheep(101101912) membrane-bound transcription factor peptidase, site 1
Zebrafish(326710) membrane-bound transcription factor protease, site 1
chicken(415704) membrane-bound transcription factor peptidase, site 1
domestic cat(101081852) membrane-bound transcription factor peptidase, site 1
cow(511682) membrane-bound transcription factor peptidase, site 1
Horse(100055849) membrane-bound transcription factor peptidase, site 1
dog(489684) membrane-bound transcription factor peptidase, site 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019709 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019709 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019709 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003791 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003791 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003791 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003791 siRNAs that have been validated in the lab human pricing
NM_201268 siRNAs that have been validated in the lab human pricing
NM_053569 Rosetta Predictions rat pricing
NM_019709 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003791 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110208 validated 1476
2 SASI_Hs02_00336297 predicted 2884
3 SASI_Hs01_00110209 predicted 777
4 SASI_Hs02_00336298 predicted 2753
5 SASI_Hs01_00110211 predicted 1533
6 SASI_Hs02_00336299 predicted 2358
7 SASI_Hs02_00336300 predicted 1116
8 SASI_Hs01_00110216 predicted 1016
9 SASI_Hs02_00336301 predicted 3378
10 SASI_Hs02_00336302 predicted 2431
11 SASI_Hs01_00110210 predicted 1494
12 SASI_Hs01_00110212 predicted 1548
13 SASI_Hs01_00110213 predicted 703
14 SASI_Hs01_00110214 predicted 763
15 SASI_Hs01_00110215 predicted 1118
16 SASI_Hs01_00110217 predicted 753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201268 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109235 validated 1480
2 SASI_Hs01_00109236 predicted 785
3 SASI_Hs01_00109237 predicted 1489
4 SASI_Hs01_00109238 predicted 1542
5 SASI_Hs01_00109239 predicted 1553
6 SASI_Hs01_00109240 predicted 702
7 SASI_Hs01_00109241 predicted 764
8 SASI_Hs01_00109242 predicted 1028
9 SASI_Hs01_00109243 predicted 2493
10 SASI_Hs01_00109244 predicted 1778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053569 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080169 predicted 685
2 SASI_Rn02_00266231 predicted 2207
3 SASI_Rn01_00080170 predicted 930
4 SASI_Rn01_00080171 predicted 2840
5 SASI_Rn02_00266232 predicted 2345
6 SASI_Rn01_00080173 predicted 697
7 SASI_Rn01_00080174 predicted 686
8 SASI_Rn01_00080175 predicted 1503
9 SASI_Rn01_00080176 predicted 1476
10 SASI_Rn01_00080177 predicted 2586
11 SASI_Rn01_00080172 predicted 2224
12 SASI_Rn01_00080178 predicted 1042
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019709 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030369 predicted 3407
2 SASI_Mm01_00030371 predicted 1082
3 SASI_Mm01_00030372 predicted 2980
4 SASI_Mm01_00030373 predicted 2938
5 SASI_Mm01_00030374 predicted 2893
6 SASI_Mm01_00030375 predicted 2477
7 SASI_Mm02_00324821 predicted 1599
8 SASI_Mm02_00324822 predicted 759
9 SASI_Mm01_00030376 predicted 692
10 SASI_Mm01_00030377 predicted 3327
11 SASI_Mm01_00030370 predicted 821
12 SASI_Mm01_00030378 predicted 1620
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019709
VALIDATED
MBTPS1 MISSION shRNA Bacterial Glycerol Stock
membrane-bound transcription factor peptidase, site 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019709.3-2157s1c1
Sequence:CCGGCGACCCTATTTACCACAGAATCTCGAGATTCTGTGGTAAATAGGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019709.3-2063s1c1
Sequence:CCGGGCCTATCTACTATGGAGGAATCTCGAGATTCCTCCATAGTAGATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019709.3-3273s1c1
Sequence:CCGGCGGTACTCCAAAGTTCTTGAACTCGAGTTCAAGAACTTTGGAGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019709.3-2484s1c1
Sequence:CCGGCGGATGAAGAATGACCCTTTACTCGAGTAAAGGGTCATTCTTCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019709.3-3378s1c1
Sequence:CCGGGCACCCAGTAATCTTTGGAAACTCGAGTTTCCAAAGATTACTGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019709.3-2063s21c1
Sequence:CCGGGCCTATCTACTATGGAGGAATCTCGAGATTCCTCCATAGTAGATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019709.3-3273s21c1
Sequence:CCGGCGGTACTCCAAAGTTCTTGAACTCGAGTTCAAGAACTTTGGAGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019709.3-2484s21c1
Sequence:CCGGCGGATGAAGAATGACCCTTTACTCGAGTAAAGGGTCATTCTTCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019709.3-3378s21c1
Sequence:CCGGGCACCCAGTAATCTTTGGAAACTCGAGTTTCCAAAGATTACTGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019709.3-2157s21c1
Sequence:CCGGCGACCCTATTTACCACAGAATCTCGAGATTCTGTGGTAAATAGGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019709
VALIDATED
MBTPS1 MISSION shRNA shRNA Plasmid DNA
membrane-bound transcription factor peptidase, site 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019709.3-2157s1c1
Sequence:CCGGCGACCCTATTTACCACAGAATCTCGAGATTCTGTGGTAAATAGGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019709.3-2063s1c1
Sequence:CCGGGCCTATCTACTATGGAGGAATCTCGAGATTCCTCCATAGTAGATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019709.3-3273s1c1
Sequence:CCGGCGGTACTCCAAAGTTCTTGAACTCGAGTTCAAGAACTTTGGAGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019709.3-2484s1c1
Sequence:CCGGCGGATGAAGAATGACCCTTTACTCGAGTAAAGGGTCATTCTTCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019709.3-3378s1c1
Sequence:CCGGGCACCCAGTAATCTTTGGAAACTCGAGTTTCCAAAGATTACTGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019709.3-2063s21c1
Sequence:CCGGGCCTATCTACTATGGAGGAATCTCGAGATTCCTCCATAGTAGATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019709.3-3273s21c1
Sequence:CCGGCGGTACTCCAAAGTTCTTGAACTCGAGTTCAAGAACTTTGGAGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019709.3-2484s21c1
Sequence:CCGGCGGATGAAGAATGACCCTTTACTCGAGTAAAGGGTCATTCTTCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019709.3-3378s21c1
Sequence:CCGGGCACCCAGTAATCTTTGGAAACTCGAGTTTCCAAAGATTACTGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019709.3-2157s21c1
Sequence:CCGGCGACCCTATTTACCACAGAATCTCGAGATTCTGTGGTAAATAGGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019709
VALIDATED
MBTPS1 MISSION shRNA Lentiviral Transduction Particles
membrane-bound transcription factor peptidase, site 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019709.3-2157s1c1
Sequence:CCGGCGACCCTATTTACCACAGAATCTCGAGATTCTGTGGTAAATAGGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019709.3-2063s1c1
Sequence:CCGGGCCTATCTACTATGGAGGAATCTCGAGATTCCTCCATAGTAGATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019709.3-3273s1c1
Sequence:CCGGCGGTACTCCAAAGTTCTTGAACTCGAGTTCAAGAACTTTGGAGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019709.3-2484s1c1
Sequence:CCGGCGGATGAAGAATGACCCTTTACTCGAGTAAAGGGTCATTCTTCATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019709.3-3378s1c1
Sequence:CCGGGCACCCAGTAATCTTTGGAAACTCGAGTTTCCAAAGATTACTGGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019709.3-2063s21c1
Sequence:CCGGGCCTATCTACTATGGAGGAATCTCGAGATTCCTCCATAGTAGATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019709.3-3273s21c1
Sequence:CCGGCGGTACTCCAAAGTTCTTGAACTCGAGTTCAAGAACTTTGGAGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019709.3-2484s21c1
Sequence:CCGGCGGATGAAGAATGACCCTTTACTCGAGTAAAGGGTCATTCTTCATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019709.3-3378s21c1
Sequence:CCGGGCACCCAGTAATCTTTGGAAACTCGAGTTTCCAAAGATTACTGGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019709.3-2157s21c1
Sequence:CCGGCGACCCTATTTACCACAGAATCTCGAGATTCTGTGGTAAATAGGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003791
VALIDATED
MBTPS1 MISSION shRNA Bacterial Glycerol Stock
membrane-bound transcription factor peptidase, site 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003791.2-3770s1c1
Sequence:CCGGGCAGGTTTGTTAGAGTCTGTTCTCGAGAACAGACTCTAACAAACCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003791.2-1405s1c1
Sequence:CCGGCGACGTGTTAAACCTCAGCATCTCGAGATGCTGAGGTTTAACACGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003791.2-1481s1c1
Sequence:CCGGGCTAACAATGTAATCATGGTTCTCGAGAACCATGATTACATTGTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003791.2-622s1c1
Sequence:CCGGCCTGACTTTGAAGGTGGAATTCTCGAGAATTCCACCTTCAAAGTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003791.2-2901s1c1
Sequence:CCGGGCGTCGTGATAACACAGACTTCTCGAGAAGTCTGTGTTATCACGACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353575    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003791.2-4018s21c1
Sequence:CCGGGACGCTTGTTAAAGGCTATTTCTCGAGAAATAGCCTTTAACAAGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003791.2-1374s21c1
Sequence:CCGGACGCCTTCAACTATGCCATTTCTCGAGAAATGGCATAGTTGAAGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003791.2-1405s21c1
Sequence:CCGGCGACGTGTTAAACCTCAGCATCTCGAGATGCTGAGGTTTAACACGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003791.2-1540s21c1
Sequence:CCGGGAATAACCCTGCTGATCAAATCTCGAGATTTGATCAGCAGGGTTATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003791.2-2396s21c1
Sequence:CCGGCGCTATCCACCTGGCTATTTCCTCGAGGAAATAGCCAGGTGGATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003791
VALIDATED
MBTPS1 MISSION shRNA shRNA Plasmid DNA
membrane-bound transcription factor peptidase, site 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003791.2-3770s1c1
Sequence:CCGGGCAGGTTTGTTAGAGTCTGTTCTCGAGAACAGACTCTAACAAACCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003791.2-1405s1c1
Sequence:CCGGCGACGTGTTAAACCTCAGCATCTCGAGATGCTGAGGTTTAACACGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003791.2-1481s1c1
Sequence:CCGGGCTAACAATGTAATCATGGTTCTCGAGAACCATGATTACATTGTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003791.2-622s1c1
Sequence:CCGGCCTGACTTTGAAGGTGGAATTCTCGAGAATTCCACCTTCAAAGTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003791.2-2901s1c1
Sequence:CCGGGCGTCGTGATAACACAGACTTCTCGAGAAGTCTGTGTTATCACGACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353575    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003791.2-4018s21c1
Sequence:CCGGGACGCTTGTTAAAGGCTATTTCTCGAGAAATAGCCTTTAACAAGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003791.2-1374s21c1
Sequence:CCGGACGCCTTCAACTATGCCATTTCTCGAGAAATGGCATAGTTGAAGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003791.2-1405s21c1
Sequence:CCGGCGACGTGTTAAACCTCAGCATCTCGAGATGCTGAGGTTTAACACGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003791.2-1540s21c1
Sequence:CCGGGAATAACCCTGCTGATCAAATCTCGAGATTTGATCAGCAGGGTTATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003791.2-2396s21c1
Sequence:CCGGCGCTATCCACCTGGCTATTTCCTCGAGGAAATAGCCAGGTGGATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003791
VALIDATED
MBTPS1 MISSION shRNA Lentiviral Transduction Particles
membrane-bound transcription factor peptidase, site 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003791.2-3770s1c1
Sequence:CCGGGCAGGTTTGTTAGAGTCTGTTCTCGAGAACAGACTCTAACAAACCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003791.2-1405s1c1
Sequence:CCGGCGACGTGTTAAACCTCAGCATCTCGAGATGCTGAGGTTTAACACGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003791.2-1481s1c1
Sequence:CCGGGCTAACAATGTAATCATGGTTCTCGAGAACCATGATTACATTGTTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003791.2-622s1c1
Sequence:CCGGCCTGACTTTGAAGGTGGAATTCTCGAGAATTCCACCTTCAAAGTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003791.2-2901s1c1
Sequence:CCGGGCGTCGTGATAACACAGACTTCTCGAGAAGTCTGTGTTATCACGACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353575    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003791.2-4018s21c1
Sequence:CCGGGACGCTTGTTAAAGGCTATTTCTCGAGAAATAGCCTTTAACAAGCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003791.2-1374s21c1
Sequence:CCGGACGCCTTCAACTATGCCATTTCTCGAGAAATGGCATAGTTGAAGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003791.2-1405s21c1
Sequence:CCGGCGACGTGTTAAACCTCAGCATCTCGAGATGCTGAGGTTTAACACGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003791.2-1540s21c1
Sequence:CCGGGAATAACCCTGCTGATCAAATCTCGAGATTTGATCAGCAGGGTTATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003791.2-2396s21c1
Sequence:CCGGCGCTATCCACCTGGCTATTTCCTCGAGGAAATAGCCAGGTGGATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)